Overblog
Suivre ce blog Administration + Créer mon blog

Contact : Administrateur@henrydarthenay.com

  • : Vouillé un peu d'Histoire
  • : Histoire, politique historique comparée, économie, finance, généalogie, techniques Moyen âge,
  • Contact

vous êtes 152 000 visiteurs 248 000 pages et je vous en remercie vues , merci de votre visite

contact :henry.darthenay@hotmail.fr
 
Facebook :
 
https://www.facebook.com/people/Henry-Darthenay/1649294905
 
Musique (un florilège d'oeuvres musicales) :
 
 http://www.youtube.com/user/henrydarthenay
 
 

Recherche

2 février 2021 2 02 /02 /février /2021 18:55

La plus grande expérience sur les humains jamais vue.

Elevage de cobaye – Adisco – Appui au Développement ...

Quelle est l’approche la plus raisonnable qu’une société pourrait adopter en cas d’épidémie :

1. Mettre les malades en quarantaine et prendre des précautions raisonnables pour empêcher ceux qui sont identifiés comme vulnérables de contracter la maladie.

2. Tenter de « contrôler le virus » en empêchant des millions de personnes en bonne santé d’avoir des contacts avec d’autres personnes en bonne santé.

Pour toute société avant 2020, il aurait été évident que la première approche est non seulement logique et proportionnée, mais aussi la moins susceptible d’avoir d’autres conséquences non voulues et hautement destructrices. Toutefois, à mon grand étonnement, de nombreux membres de notre société croient non seulement que la réponse est la deuxième, mais aussi qu’elle est fondée sur des données scientifiques établies.

Je comprends maintenant que beaucoup de ceux qui soutiennent les confinements s’opposeront à ma caractérisation de leur position. Ils diront qu’elle est délibérément trompeuse, puisqu’elle parle de personnes en bonne santé, et ne mentionne pas les malades. Ces objections se fondent toutefois sur ce fait indéniable : les confinement sont, par nature, une approche totalement non ciblée et sans discernement d’un problème de santé, et l’interdiction par la loi de millions de personnes en bonne santé d’avoir des contacts avec d’autres personnes en bonne santé est une caractéristique, et non un bogue d’une politique qui n’a pas été testée et éprouvée avant d’être mise en œuvre pour la première fois par le parti communiste chinois en janvier de l’année dernière, puis copiée par de nombreux gouvernements dans le monde entier par la suite.

Pour une raison quelconque, de nombreux adeptes du confinement semblent penser qu’il incombe aux opposants au régime de réfuter leur position. Mais comme le souligne le Dr Malcolm Kendrick dans son excellent article Does Lockdown Work or Not, c’est le contraire de la façon dont les choses sont censées fonctionner :

« Le point de départ, pour toute hypothèse scientifique, est que les partisans réfutent l’hypothèse nulle. Exiger de ceux qui croient que quelque chose peut ne pas fonctionner, pour prouver que ce n’est pas le cas, c’est mettre la méthode scientifique sens dessus dessous. On ne peut jamais prouver une hypothèse négative. »

Malgré cela, il poursuit en soulignant que la plupart des pays ayant le plus grand nombre de décès par million sont ceux qui ont mis en place des mesures de confinement assez strictes, et donc les données jusqu’à présent ne montrent certainement pas que les mesures de confinement sont efficaces, même selon leurs propres termes. Bien sûr, la logique Covidienne a toujours une réponse à cela, à savoir que ces confinements n’étaient pas de véritables confinements. Ils étaient trop peu, trop tard, trop doux, trop indulgents, trop courts, trop petits, trop violets ou quelque chose comme ça ! Mais ils ne peuvent jamais se tromper. Le faible taux de mortalité montre qu’ils fonctionnent. Un taux de mortalité élevé montre qu’ils auraient fonctionné si seulement les gens n’avaient pas été mauvais.

Mais ce que je veux surtout dire, c’est qu’il ne s’agit pas de quelque chose qui a été proposé, étudié ou testé auparavant, mais d’une pratique entièrement nouvelle, imposée au monde pour la première fois en 2020. Ce qui veut dire quoi ? Cela signifie qu’il s’agit d’une expérience en temps réel. Cela signifie que notre société (ainsi que beaucoup d’autres) a fait l’objet d’une expérience au cours de l’année écoulée et continue de le faire dans un avenir proche. En fait, il s’agit de la plus grande expérience psychologique, sociale et expérimentale jamais menée.

Lorsque j’utilise ce genre de langage, il a tendance à rencontrer la réponse moqueuse suivante : « Alors, vous dites que tout cela n’est qu’une conspiration de masse ? Qui est le marionnettiste alors ? » Mais là, on passe à côté de l’essentiel. Il n’est pas nécessaire qu’un Seigneur des Ténèbres soit assis au-dessus de tout cela pour que ce soit une expérience, bien qu’il faille dire que des personnes comme le professeur Schwab semblent vouloir se présenter comme d’assez bons candidats. Non, il s’agit simplement, par définition, d’une expérience psychologique, sociale et économique par la nature même du fait que la mise en quarantaine et le masquage de masse de millions de personnes, qui ne peuvent manquer de changer la psychologie, la société et l’économie, sont des méthodes non testées, non éprouvées, basées sur de simples hypothèses et non sur des données concrètes. En fait, les données proviennent toujours de cette énorme expérience, mais comme le dit le Dr Kendrick, elles ne sont pas vraiment bonnes pour l’hypothèse :

« …je conclurais que les études d’observation n’ont pas – jusqu’à présent – réussi à réfuter l’hypothèse nulle. En fait, les preuves recueillies jusqu’à présent pourraient suggérer que les confinements pourraient en fait augmenter le taux de mortalité. En bref, je chercherais une autre idée. »

Mais l’expérimentation psychologique, sociale et économique n’est en aucun cas terminée. Nous sommes maintenant passés à l’expérimentation médicale, c’est-à-dire à l’administration de « vaccins » à des millions de personnes (appelés ainsi parce qu’ils n’empêchent pas réellement les gens de contracter le virus et qu’on ne sait pas encore s’ils empêchent la transmission).

Incroyablement, si vous regardez l’essai clinique de Pfizer BioNTech SE sur la base de données des essais cliniques de la Bibliothèque nationale de médecine des États-Unis, vous remarquerez quelque chose de très étrange, à savoir que la date d’achèvement estimée de l’étude est le 31 janvier 2023. C’est le cas ici :

« la date à laquelle le dernier participant à une étude clinique a été examiné ou a reçu une intervention/un traitement afin de recueillir les données finales pour les mesures de résultats primaires, les mesures de résultats secondaires et les événements indésirables. »

En d’autres termes, les effets secondaires à moyen et long terme de ce produit ne peuvent pas être connus, car l’étude est toujours en cours. En résumé, comme le souligne le professeur Sucharit Bhakdi dans cette excellente interview (à regarder avant que les Gatekeepers de YouTube ne la fasse disparaître), chaque personne qui reçoit aujourd’hui ces piqûres est en fait un sujet d’essai involontaire dans le cadre de la plus grande expérience médicale jamais réalisée, puisqu’on lui a demandé de donner son consentement pour recevoir un produit injecté dans son corps sans être correctement informé du statut du produit.

En d’autres termes, ni les personnes qui administrent ces piqûres ni celles qui les reçoivent ne peuvent avoir la moindre idée des conséquences potentielles à moyen et long terme de ces choses, car les sociétés qui les produisent n’ont pas terminé les études qui les concernent. Et non, ce n’est pas la marque d’un anti-vaccin que d’être profondément préoccupé par cela (je ne le suis pas) ; c’est juste la marque d’avoir son sens critique en état de marche et de se soucier de ce qui est fait aux gens – cela s’appelle aimer son voisin comme soi-même.

En résumé, tant le confinement que les « vaccins » sont essentiellement une expérience de masse sur l’humanité. Les conséquences à moyen et long terme de ces deux types de mesures sont totalement inconnues. Les générations futures s’émerveilleront de la façon dont les autorités ont pu y parvenir, mais elles s’émerveilleront encore plus de la façon dont des millions de personnes ont accepté sans réfléchir. Rien de tout cela ne peut être de bon augure. Nous devons faire preuve d’humilité et examiner attentivement ce que nous faisons, ou permettons que l’on nous fasse, de toute urgence.

 

Source : TheBlogMire

Partager cet article
Repost0
2 février 2021 2 02 /02 /février /2021 18:50
Que ce soit Trump ou Biden, les Européens sont toujours les vassaux de l’oncle Sam

La présomption de Biden de dire aux Européens que le gazoduc Nord Stream-2 est une mauvaise affaire montre qu’en fin de compte, les Européens sont considérés comme n’ayant pas de souveraineté lorsqu’il s’agit de définir leur politique énergétique.

L’Union européenne a reçu cette semaine un mémo grossier indiquant qu’un nouveau président pourrait résider à Washington, mais c’est toujours la même politique américaine de les traiter comme des vassaux.

 

Le président démocrate Joe Biden a peut-être plus de finesse et de sensibilité transatlantique que le républicain Donald Trump. Mais en fin de compte, Joe Biden se sent tout aussi en droit que son prédécesseur de donner des ordres aux Européens comme à une bande de larbins. Peut-être pas avec la même rhétorique laconique, mais avec la même attitude autoritaire.

Cela ressort clairement de la déclaration de l’administration Biden sur le projet de gaz naturel Nord Stream-2, qui doit bientôt être achevé entre la Russie et l’Europe. “Le président Biden pense que c’est un mauvais accord pour l’Europe”, a déclaré le porte-parole de la Maison Blanche, Jan Psaki, avec un air de finalité sur la question.

La nouvelle administration étudie les moyens de mettre en œuvre les sanctions formulées par le précédent Trump, qui viseront les entreprises européennes impliquées dans la construction du projet gazier. Après une année de suspension des travaux en raison des sanctions américaines, la construction du gazoduc Nord Stream-2 a repris cette semaine. Ce projet de 10 milliards d’euros, qui prévoit la construction de 1 225 kilomètres de gazoduc sous la mer Baltique entre la Russie et l’Allemagne, est achevé à plus de 95 %. Les derniers kilomètres de canalisation ont repris dans les eaux danoises en direction des côtes allemandes.

La nouvelle ligne d’approvisionnement Nord Stream doublera le volume actuel de gaz naturel livré de la Russie à l’Allemagne et au reste de l’Union européenne. L’augmentation de la consommation de gaz naturel plus propre est cruciale pour les plans allemands visant à s’éloigner du charbon sale et de l’énergie nucléaire. Le gaz russe est également beaucoup plus économique que les sources alternatives telles que les projets américains d’exportation de gaz naturel liquéfié par voie maritime.

En effet, la Russie s’est opposée aux sanctions américaines sur Nord Stream-2, au motif que Washington tente de renforcer les décisions commerciales en utilisant des instruments politiques. (Tant que ça pour le capitalisme américain de libre échange !)

La chancelière allemande Angela Merkel a réitéré l’engagement de son gouvernement à terminer le projet Nord Stream-2. Les consortiums d’entreprises allemands ont également souligné l’importance stratégique de garantir un approvisionnement abordable en énergie gazière pour la croissance économique future. Le coût de l’énergie est primordial pour l’économie allemande axée sur l’exportation ainsi que pour réduire les factures des ménages.

Cet engagement allemand est pris en dépit de la controverse sur la figure de l’opposition russe Alexei Navalny qui a été transporté en Allemagne en août dernier en prétendant avoir été empoisonné par le Kremlin dans le cadre d’un étrange complot d’assassinat. Le Kremlin a catégoriquement rejeté ces affirmations comme une provocation délibérée, suggérant l’implication des services secrets occidentaux dans une tentative de déstabilisation de la Russie. Navalny a séjourné en Allemagne pendant près de cinq mois en tant qu’invité de facto du gouvernement de Berlin. A son retour à Moscou le 17 janvier, il a été arrêté pour violation de sa licence de libération conditionnelle pour une peine avec sursis concernant une condamnation pour fraude passée.

Merkel et d’autres politiciens allemands ont certainement apporté à Navalny un grand soutien médiatique pour ses allégations non fondées contre le Kremlin. Leur indulgence à l’égard de ces accusations provocatrices est certainement un mépris méprisable de la souveraineté et des lois russes, élevant un agitateur douteux au rang de président Vladimir Poutine.

 

Cependant, les Allemands ne sont pas si stupides. Ils savent très bien que l’abandon du Nord Stream-2 équivaut à tirer sur leur économie à deux pieds. C’est pourquoi, malgré le brouhaha autour de Navalny, Berlin s’en tient à Nord Stream-2.

Voici donc Joe Biden. Le président est censé dire aux Européens ce qu’il pense être bon ou mauvais pour eux. Un leader américain d’outre-Atlantique hurle aux États européens que prendre livraison du gaz russe économique n’est “pas une bonne affaire”.

Bien sûr, les Américains doivent déguiser leurs intérêts commerciaux et stratégiques nus avec la tenue rhétorique selon laquelle Washington ne s’inquiète “que” de voir l’Europe exploitée par le chantage politique russe si l’Europe dépend de Moscou pour son approvisionnement en gaz. La conclusion étant que la Russie pourrait couper les lignes de gaz chaque fois que cela serait politiquement opportun. Ce point de vue cynique est fondé sur la sombre russophobie et, en tout état de cause, d’un point de vue juridique et contractuel, il serait peu plausible.

L’opposition arrogante de Biden au Nord Stream-2 n’est pas seulement la continuation de la politique de l’administration Trump. Dans les anciennes administrations Obama (2008-2016), où Biden était vice-président, la politique consistait également à s’opposer à l’ambitieux projet gazier, qui a débuté en 2011.

Avec Trump, la plupart des dirigeants européens en sont venus à détester ses manières effrontées et grossières. Avec son slogan “America First”, Trump a intimidé les Européens au sujet de prétendus tarifs douaniers injustes ainsi que pour avoir prétendument relâché ses engagements en matière de dépenses militaires envers l’OTAN. Seuls la Pologne et les États baltes de droite semblent avoir eu une faveur pour Trump, qu’ils admiraient pour ses sanctions anti-russes concernant Nord Stream-2.

Maintenant que Biden est à la Maison Blanche, plusieurs dirigeants européens ont exprimé leur soulagement et ont accueilli chaleureusement le nouveau président qui parle ouvertement de renouveler et de renforcer l’alliance transatlantique. La croyance implicite est que Biden apprécie les alliés européens d’une manière que le vulgaire Trump n’appréciait pas.

Toute notion de nouvelle appréciation américaine des alliés européens devrait être écartée. La présomption de Biden de dire aux Européens que Nord Stream-2 est une mauvaise affaire montre qu’en fin de compte, les Européens sont considérés comme n’ayant pas de souveraineté lorsqu’il s’agit de définir leur politique énergétique. L’oncle Sam, comme toujours, sait ce qu’il faut faire pour ses petits vassaux européens.

Source: The Strategic Culture Foundation, le 1er février 2021

Partager cet article
Repost0
2 février 2021 2 02 /02 /février /2021 18:13

Par Valérie Bugault – Janvier 2021

valerie_bugault

Bonjour, docteur en droit et ancienne avocate fiscaliste, je viens de créer mon site internet avec, pour vocation, de réformer le droit en profondeur.

Il faut partir du simple constat que la domination hégémonique du modèle de droit des affaires anglo-saxon a vidé de sa substance le Droit au sens où nous l’entendions sur le continent européen. Pour arriver à ma volonté de revenir à un droit commun, de nature civil, c’est-à-dire bannir la conception marchande du droit aujourd’hui à l’œuvre ; cette déviance du droit se traduit principalement, en droit français, par la mise en œuvre juridique sournoise du concept de « propriété économique ».

 
 
Mise à jour du 17 Janvier 2021
 

J’ai pour ambition de rendre à l’État la juste place, politique, qui est la sienne et de remettre les entreprises à la juste place qui est la leur. A cette fin, j’ai notamment déjà développé deux théories juridiques, une sur l’entreprise, l’autre sur la monnaie, qui doivent servir de fil directeur à la Rénovation du droit. J’ai également fait des propositions de réforme de l’organisation de l’État. Vous trouverez l’ensemble de mes travaux centralisé sur mon site internet.

Toutefois, au-delà des travaux déjà entrepris, il reste beaucoup à faire, en particulier à dépoussiérer le droit actuel de ses scories amassés par les velléités commercialistes de règlementation tout azimut. A cette fin, j’ai donc pris l’initiative de créer un Cercle de Réflexion du droit appelé « RévoluDroit », dont la finalité est de développer une École de Droit alternatif dont les fondamentaux suivront l’ordre naturel, et iront en conséquence dans le sens du droit naturel, concept devant lui-même être rénové. Vous trouverez l’essentiel des informations dans la page « RévoluDroit » de mon site.

J’appelle tous les juristes intéressés à me contacter et, le cas échéant, à me rejoindre via le formulaire « contact » situé sur mon site internet : valeriebugault.fr

 

Je vous propose également cet article sur la dette mais les chiffres de l'endettement ont considérablement augmentés, Merci !

Partager cet article
Repost0
1 février 2021 1 01 /02 /février /2021 19:21

Une bombe à retardement :

 

Quiconque est impliqué de quelque manière que ce soit en cas d'ingérence étrangère verra tous ses avoirs gelés le 1er février 2021qu'il soit soupçonné d'une quelconque manière pendant 30 jours avant que décisions soient prises au sujets de ceux ci qui en cas de fraude pourraient être saisis ainsi que les biens des conspirateurs.

 
1er février : le décret 13848 entre en vigueur !
 

http://

Pensez-vous que ce soit une coïncidence que le 1er février soit le "FREEDOM DAY"?

 

Folks, c'est pourquoi Wall Street devient fou en ce moment. Ils paniquent et essaient de déplacer l'argent, avant qu'il ne soit gelé. C'EST INTÉRESSANT!

 

Si vous n'avez pas lu entièrement l'ordonnance exécutive sur le contrôle électoral, le moment est venu de le faire !

 

45 jours du 3 novembre 2020 au 18 décembre 2020 + 45 jours du 18 décembre 2020 au 1er février 2021!

 

 

Pensez-y ... Le président Donald Trump est le 45e président des États-Unis.

 

Le président Donald J.Trump a signé le décret 13848 le 12 septembre 2018

 

Imposer certaines sanctions en cas d'ingérence étrangère dans une élection aux États-Unis

 

Par l'autorité qui m'est conférée en tant que président par la constitution et les lois des États-Unis d'Amérique, y compris l'International Emergency Economic Powers Act (50 USC 1701 et suiv.) (IEEPA), le National Emergencies Act (50 USC 1601 et suiv. ) (NEA), article 212 (f) de la loi sur l'immigration et la nationalité de 1952 (8 USC 1182 (f)) et article 301 du titre 3, United States Code, 

 

Je déclare, DONALD J. TRUMP , Président des États-Unis d'Amérique, que les personnes qui se trouvent totalement ou substantiellement en dehors des États-Unis ont la capacité d'intervenir dans les élections aux États-Unis ou que la confiance du public dans ces élections sape, y compris des personnes non autorisées. l'accès aux infrastructures électorales et électorales ou la diffusion secrète de propagande et de désinformation constituent une menace inhabituelle et exceptionnelle pour la sécurité nationale et la politique étrangère des États-Unis.

 

Fondamentalement, ce règlement stipule que toute personne impliquée dans l'ingérence dans les élections de 2020 ou dans le soutien d'élections frauduleuses au pays ou à l'étranger verra ses biens et ses avoirs gelés.

 

Cela inclut les médias grand public, les médias sociaux et toutes les autres personnes impliquées dans le vol de ce choix.

=====

45 jours du 3 novembre 2020 au 18 décembre. 

Pendant cette période, DNI John Ratcliffe a collecté des données sur la fraude électorale.

 

Section 1. (a):

Au plus tard 45 jours après la conclusion d'une élection aux États-Unis, le directeur du renseignement national, en consultation avec les chefs d'autres départements et agences (agences) exécutifs appropriés, évalue toute information indicative de l'existence d'un gouvernement étranger ou de toute personne agissant en tant que représentant ou au nom d'un gouvernement étranger a agi avec l'intention ou le but d'interférer dans cette élection.

L'évaluation identifiera la nature de l'ingérence étrangère et les méthodes utilisées pour la réaliser, les personnes impliquées et le ou les gouvernements étrangers qui l'ont approuvée, dirigée, parrainée ou aidée, le cas échéant. Le directeur des services nationaux de renseignement transmettra cette évaluation et les informations connexes au président, au ministre des Affaires étrangères, au ministre des Finances, au ministre de la Défense, au procureur général et au ministre de la Sécurité intérieure.

 

Après cela, 45 jours supplémentaires sont autorisés pour la rédaction et la soumission du rapport. C'est pourquoi le procureur général Barr n'a rien vu avant de quitter l'administration Trump. Il n'avait pas été livré à son département à ce moment-là. C'était entre les mains d'autres autorités. La société dit qu'il n'y a aucune excuse pour l'ignorance de la loi, mais allez les gars ... pouvez-vous nous jeter tous un os de temps en temps? Au moins, cela nous a permis de creuser dans le noir, et nous rattrapons tous tous les domaines que nous ne connaissions pas et dont nous n'étions pas non plus informés. Tout cela fait partie de la propriété de l'entreprise. Je veux dire, qui va expliquer ce qu'ils font à leur propriété? Parlez-vous à votre voiture? Avec vos plats? Je pense,

 

=====

 

45 jours du 18 décembre au 1er février

 

Cette période a permis à DNI John Ratcliffe de compiler toutes les données, de compiler le rapport de fraude électorale et de remettre le rapport au président Trump.

 

Section 1. (b):

 

Dans les 45 jours suivant la réception de l'évaluation et des informations décrites à la section 1 (a) du présent arrêté, le procureur général et le ministre de la Sécurité intérieure, en consultation avec les chefs de toutes les autres autorités compétentes et, le cas échéant, les autorités nationales et locales, transmet au président, au secrétaire d'État un rapport au secrétaire au Trésor et au secrétaire à la Défense évaluant l'élection aux États-Unis sous réserve de l'évaluation décrite à la section 1 (a):

 

======

 

Puis, le 1er février ou après, les choses commencent vraiment à se produire:

 

Section 2. (a):

Tous les biens et intérêts de propriété situés aux États-Unis, qui tomberont plus tard aux États-Unis, ou qui tomberont plus tard en la possession ou le contrôle de toute personne américaine des éléments suivants, seront bloqués et transférer, payer, exporter, retirer ou traiter d'une autre manière toute personne étrangère désignée par le secrétaire au Trésor en consultation avec le secrétaire d'État, le procureur général et le secrétaire à la Sécurité intérieure:

(i) directement ou indirectement impliquée dans une ingérence aux États-Unis pour avoir été impliqué, avoir parrainé, dissimulé ou rendu complice;

(ii) le soutien matériel, le parrainage ou le soutien financier, matériel ou technologique pour, ou les biens ou services pour, ou à l'appui des activités décrites au sous-alinéa (a) (i) du présent article, ou par des personnes dont les biens et intérêts sont conformément à verrouillé à cet arrangement; ou

(iii) être détenu ou contrôlé par, ou agir ou agir par, toute personne qui agit, directement ou indirectement, pour ou au nom de toute personne dont la propriété ou les intérêts sont bloqués en vertu de la présente ordonnance.

(b) Le décret 13694 du 1er avril 2015, tel que modifié par le décret 13757 du 28 décembre 2016, reste en vigueur. Cet arrêté n'a pas pour but et ne servira pas à limiter le pouvoir discrétionnaire du ministre des Finances dans l'exercice des pouvoirs prévus par le décret 13694. Le cas échéant, le secrétaire au Trésor, en consultation avec le procureur général et le secrétaire d'État, peut exercer les pouvoirs énoncés dans le décret 13694 ou d'autres pouvoirs en relation avec l'exercice par le secrétaire au Trésor des pouvoirs prévus dans le présent arrêté.

 

(c) Les interdictions de la sous-section (a) de la présente section s'appliquent sauf dans la mesure prévue par la loi ou toute ordonnance, ordonnance, directive ou licence qui peut être émise en vertu de la présente ordonnance, et nonobstant tout ce qui a été conclu avant la date de cette commande Contrats ou licences ou permis accordés.

 

Paragraphe 3. Après avoir soumis l'évaluation requise à la section 1 (a) et le rapport requis à la section 1 (b):

 

(a) Le secrétaire au Trésor examine l'évaluation requise par l'article 1 (a) et le rapport requis par l'article 1 (b) et, en consultation avec le secrétaire d'État, le procureur général et le ministre de la Sécurité intérieure, impose les sanctions appropriées en vertu de la section 2 (a) de la présente ordonnance et toute pénalité raisonnable décrite à la section 2 (b) de la présente ordonnance; et

 

s'ils ne s'appliquent pas aux plus grandes unités commerciales de ce pays, secteurs d'importance stratégique comparable pour ce gouvernement étranger). La recommandation doit comprendre une évaluation de l’impact des sanctions recommandées sur les intérêts économiques et de sécurité nationale des États-Unis et de leurs alliés. Toute sanction recommandée doit être adaptée de manière appropriée à l'ampleur de la nuisance étrangère identifiée et peut inclure une ou plusieurs des mesures suivantes en relation avec chaque cible étrangère La recommandation doit comprendre une évaluation de l’impact des sanctions recommandées sur les intérêts économiques et de sécurité nationale des États-Unis et de leurs alliés. Toute sanction recommandée doit être adaptée de manière appropriée à l'ampleur de la nuisance étrangère identifiée et peut inclure une ou plusieurs des mesures suivantes en relation avec chaque cible étrangère La recommandation doit comprendre une évaluation de l’impact des sanctions recommandées sur les intérêts économiques et de sécurité nationale des États-Unis et de leurs alliés. Toute sanction recommandée doit être adaptée de manière appropriée à l'ampleur de la nuisance étrangère identifiée et peut inclure une ou plusieurs des mesures suivantes en relation avec chaque cible étrangère

 

(i) bloquer et interdire toutes les transactions sur les biens ou les intérêts de toute personne relevant de la juridiction des États-Unis;

 

(ii) les restrictions de licences d'exportation en vertu de toute loi ou réglementation exigeant un examen et une approbation préalables du gouvernement des États-Unis comme condition d'exportation ou de réexportation de tout bien ou service;

 

iii) interdiction aux institutions financières américaines d’octroyer des prêts ou des crédits à quiconque;

 

(iv) les restrictions sur les opérations de change dans lesquelles une personne est impliquée;

 

(v) les interdictions de transfert de crédit ou de paiement entre ou par, via ou vers une institution financière au profit de toute personne;

 

(vi) interdiction à toute personne américaine d'investir ou d'acquérir des actions ou des titres de créance;

 

(vii) l'expulsion des États-Unis de tout dirigeant de société étrangère;

 

(viii) imposer l'une des sanctions énoncées dans le présent article à l'encontre du chef de la direction étranger d'une personne; ou

 

(ix) toute autre action autorisée par la loi.

 

=====

 

MAINTENANT À PELOSI et à d'autres - Cela explique le tollé pour l'application du 25e amendement, et lorsque cela a échoué, le tollé pour une destitution immédiate. Il explique la censure à grande échelle jusqu'à et y compris l'arrêt de plates-formes Web entières telles que Parler. Il explique toutes les divagations insensées et les actions désespérées qui étaient tous les cris d'une société en train de couler qui s'accroche à tout ce qui se trouve dans les murs du Capitole pour sauver sa cabale.

 

=====

 

ON ON WALLSTREET - Ils déplacent de l ' argent aussi vite que possible - les gestionnaires de hedge funds ont désespérément tenté de vendre à découvert autant que possible avant d' être interrompus. Il semble qu'ils aient tenté de sauver leurs avoirs avant d'être confisqués. Les mêmes actifs sont apparemment sur le point d'être gelés, conformément au décret n ° 13848 du président Trump.

 

=====

 

Points clés:

 

Dès qu'une fraude électorale est commise, une enquête commence. Dans les 45 jours, les enquêteurs doivent prouver qu'il y a eu fraude électorale.

 

Après les 45 jours, il reste 45 jours pour créer et soumettre le rapport.

 

Une fois le rapport remis, les actifs seront gelés.

 

Cela nous amène au règlement d'application sur le gel des avoirs. Cela devrait commencer le 1er février.

 

Les avoirs seront gelés pendant 30 jours pendant que les enquêtes y relatives se poursuivent.

 

L'ensemble du processus prend 90 jours à compter du jour où les avoirs sont gelés. Ce qui pourrait commencer le 1er février 2021.

 

Quiconque est impliqué de quelque manière que ce soit verra tous ses avoirs gelés.

 

Le 1er février 2021 est le jour où tout cela commence à se jouer. Même les gens qui ont conspiré ou dissimulé.

 

30 jours de gel des avoirs nous amènent à mars. Ils voient ce qui s'en vient et ils savent que c'est fait. Tout l'argent impliqué dans cela va couler.

 

Donc, une fois de plus, alors que nous traversons la chute de l'empire corporatif qui a asservi la République des États-Unis d'Amérique ... Nous, le peuple, devons tenir bon. Soyez patient et attendez le Seigneur au cas où il y aurait un tremblement de l'olivier. Restez à l'intérieur et cachez-vous un peu jusqu'à ce que le Fléau passe. FÉVRIER EST SUR LE POINT DE RETOUR ET DE RETOUR.

 

=====

 

Le président Trump a signé le décret n ° 13848 sur l'ingérence étrangère en septembre 2018. L'ordonnance explique les détails du processus et les délais associés à l'imposition de sanctions.

 

Décret exécutif 13848 du 12 septembre 2018

 

Imposer certaines sanctions en cas d'ingérence étrangère dans une élection américaine

 

Décret exécutif 13848: [ anglais ] [ allemand ]

 

Restez fort, gardez la foi, Dieu est aux commandes.

 

Source

Trevor Winchell
Administrateur du site - Journaliste d'investigation

Vu ici

Partager cet article
Repost0
1 février 2021 1 01 /02 /février /2021 19:05

Le Président russe Vladimir Poutine a participé à distance au Forum annuel de Davos, qui a lieu cette année du 25 au 29 janvier 2021. Il a évoqué de un risque de conflit majeur inhérent a une situation internationale instable, il a mis en évidence le rôle des multinationales en état de monopole qui s'arrogent les droits des peuples et entrent en concurrence avec les états, déstabilisant un peu plus l'équilibre fragile des sociétés Occidentales. Il a également appuyé sur le fait que "l 'ère associée aux tentatives de construction d’un ordre mondial centralisé et unipolaire, cette époque est révolue" par le simple fait que cela dépend de la volonté consensuelle de tous les axes planétaires et non la décision unilatérales de quelques uns.

Donc je vous prie de lire ce discours car il en dit assez long sur la situation avec une analyse feutrée mais très juste et efficace.

https://s2.qwant.com/thumbr/0x0/6/3/8a013e2f3f0d3a2a249bfeb1e81af5790938f0c7d67ae504dfc4bd3c5a9046/648x360_vladimir-poutine-encore-pris-gafam.jpg?u=https%3A%2F%2Fimg.20mn.fr%2FyYtG7yjgQeSPCA6mX_PIQw%2F648x360_vladimir-poutine-encore-pris-gafam.jpg&q=0&b=1&p=0&a=1

Cher M. Schwab, cher Klaus ! Chers collègues !

J’ai assisté à de nombreux événements organisés par M. Schwab dans les années 90. Klaus vient de se rappeler que nous nous sommes rencontrés en 1992. Au cours de mon travail à Saint-Pétersbourg, j’ai assisté à plusieurs reprises à ce forum consultatif. Je tiens à vous remercier pour l’occasion qui m’est donnée aujourd’hui d’apporter mon point de vue à la communauté des experts, qui se réunit sur cette plateforme mondialement reconnue grâce aux efforts de M. Schwab.

Tout d’abord, Mesdames et Messieurs, je tiens à vous souhaiter à tous la bienvenue au Forum économique mondial.

Il est agréable de constater que cette année, malgré la pandémie, malgré toutes les restrictions, le forum poursuit encore ses travaux. Bien qu’il soit en ligne, il fonctionne toujours et donne aux participants l’occasion de partager leurs évaluations et leurs prévisions dans le cadre d’une discussion ouverte et libre, ce qui compense en partie le manque de communication directe entre les dirigeants, les représentants des entreprises mondiales et le public, qui s’est accumulé au cours des derniers mois. Tout cela est important à un moment où nous avons tant de questions difficiles auxquelles il faut répondre.

Le forum de cette année est le premier de la troisième décennie du XXIe siècle, et la plupart de ses thèmes portent, bien sûr, sur les profonds changements qui se produisent sur la planète.

En effet, il est difficile de ne pas remarquer des transformations fondamentales dans l’économie, la politique, la vie sociale et la technologie mondiales. La pandémie de coronavirus que Klaus vient de mentionner, et qui est devenue un sérieux défi pour l’ensemble de l’humanité, n’a fait que stimuler et accélérer les changements structurels, dont les conditions préalables étaient déjà réunies depuis longtemps. La pandémie a exacerbé les problèmes et les déséquilibres accumulés jusqu’alors dans le monde. Il y a tout lieu de croire qu’il existe des risques d’escalade des conflits. Et ces tendances peuvent se manifester pratiquement dans tous les domaines.

Bien sûr, il n’y a pas de parallèles directs dans l’histoire. Mais certains experts – je respecte leur opinion – comparent la situation actuelle avec les années 30 du siècle dernier. Vous pouvez être d’accord ou non avec cette situation. Mais à de nombreux égards, en termes d’ampleur et de nature complexe et systémique des défis et des menaces potentielles, certaines analogies sont néanmoins justifiées.

Nous assistons à une crise des modèles et des outils de développement économique antérieurs. La stratification sociale s’intensifie, tant au niveau mondial que dans les différents pays. Nous en avons déjà parlé. Mais cela entraîne à son tour une forte polarisation de l’opinion publique, provoque la croissance du populisme, du radicalisme de droite et de gauche et d’autres extrêmes, et aggrave et exacerbe les processus politiques internes, y compris dans les pays leaders.

Tout cela affecte inévitablement la nature des relations internationales et n’y apporte ni stabilité ni prévisibilité. Les institutions internationales s’affaiblissent, les conflits régionaux se multiplient et le système de sécurité mondial se dégrade.

Klaus a mentionné ma conversation d’hier avec le président des États-Unis et l’extension du traité sur la limitation des armes stratégiques. C’est certainement un pas dans la bonne direction. Néanmoins, les conflits se multiplient, comme on dit. Comme on le sait, l’incapacité et le manque de volonté de résoudre en substance de tels problèmes au XXe siècle ont conduit à la catastrophe de la Seconde Guerre mondiale.

Bien sûr, un tel conflit mondial « brûlant » est désormais, je l’espère, impossible, en principe. Je l’espère vraiment. Cela signifierait la fin de la civilisation. Mais, là encore, la situation peut évoluer de manière imprévisible et incontrôlable. Si, bien sûr, rien n’est fait pour l’empêcher. Il est possible que nous devions faire face à un véritable bouleversement du développement mondial, avec une lutte de tous contre tous, avec des tentatives de résoudre les conflits latents par la recherche d’ennemis « internes » et « externes », avec la destruction non seulement des valeurs traditionnelles (que nous chérissons en Russie), telles que la famille, mais aussi des libertés fondamentales, y compris le droit au choix et à la vie privée.

Permettez-moi de noter ici que la crise sociale et de valeurs se transforme déjà en conséquences démographiques négatives, à cause desquelles l’humanité risque de perdre des continents civilisationnels et culturels entiers.

Notre responsabilité commune aujourd’hui est d’éviter une telle perspective, semblable à une sinistre dystopie, pour assurer un développement sur une trajectoire différente, positive, harmonieuse et créative.

À cet égard, je m’attarderai sur les principaux défis auxquels, à mon avis, la communauté mondiale est actuellement confrontée.

Le premier est d’ordre socio-économique.

Oui, à en juger par les statistiques, même en dépit des crises profondes de 2008 et 2020, la période des quarante dernières années peut être qualifiée de succès, voire de super succès pour l’économie mondiale. Le PIB mondial en parité de pouvoir d’achat a doublé en termes réels par habitant depuis 1980. C’est assurément une évolution positive.

La mondialisation et la croissance intérieure ont entraîné une forte reprise dans les pays en développement, permettant à plus d’un milliard de personnes de sortir de la pauvreté. Ainsi, si l’on prend un niveau de revenu de 5,5 dollars par personne et par jour (à parité de pouvoir d’achat), la Banque Mondiale estime qu’en Chine, par exemple, le nombre de personnes à faible revenu est passé de 1,1 milliard en 1990 à moins de 300 millions ces dernières années. C’est assurément un succès pour la Chine. Et en Russie, de 64 millions de personnes en 1999 à environ 5 millions aujourd’hui. Et nous pensons qu’il s’agit également d’un progrès dans notre pays dans la direction principale, soit dit en passant.

Néanmoins, la question principale, dont la réponse permet dans une large mesure de comprendre les problèmes actuels, est de savoir quelle était la nature de cette croissance mondiale, qui en a le plus profité.

Bien sûr, comme je l’ai déjà dit, à bien des égards, les pays en développement ont bénéficié de la demande croissante pour leurs produits traditionnels et même pour de nouveaux produits. Cependant, cette intégration dans l’économie mondiale n’a pas seulement eu pour résultat des emplois et des recettes d’exportation. Mais aussi des coûts sociaux. Y compris un écart important dans les revenus des citoyens.

Qu’en est-il des économies développées, où le niveau moyen de richesse est beaucoup plus élevé ? Aussi paradoxal que cela puisse paraître, les problèmes de stratification ici dans le monde développé ont été encore plus profonds. La Banque Mondiale estime que si 3,6 millions de personnes vivaient avec moins de 5,50 dollars par jour aux États-Unis en 2000, elles étaient 5,6 millions en 2016.

Au cours de la même période, la mondialisation a entraîné une augmentation significative des profits des grandes multinationales, principalement des entreprises américaines et européennes.

D’ailleurs, en ce qui concerne les citoyens, la tendance dans les économies développées de l’Europe est la même qu’aux États-Unis.

Mais encore une fois, quand il s’agit des bénéfices des entreprises, qui en profite ? La réponse est connue, elle est évidente – un pour cent de la population.

Et que s’est-il passé dans la vie du reste des gens ? Au cours des 30 dernières années, dans certains pays développés, le revenu de plus de la moitié des citoyens en termes réels a stagné, n’a pas augmenté. Mais le coût de l’éducation et des services de santé a augmenté. Et savez-vous de combien ? Trois fois.

Cela signifie que des millions de personnes, même dans les pays riches, n’ont pas vu la perspective d’une augmentation de leurs revenus. Et ils doivent faire face à plusieurs problèmes, comment se maintenir et maintenir leurs parents en bonne santé, comment offrir aux enfants une éducation de qualité.

Il y a aussi une accumulation de personnes qui, en fait, ne sont pas employées. Par exemple, l’Organisation internationale du travail estime qu’en 2019, 21 % des jeunes du monde, soit 267 millions de personnes, n’ont ni étudié ni travaillé nulle part. Et même parmi les actifs (voici un chiffre intéressant, des chiffres intéressants), même parmi les actifs, 30 % vivent avec des revenus inférieurs à 3,2 dollars par jour à parité de pouvoir d’achat.

Ces distorsions du développement socio-économique mondial sont le résultat direct des politiques menées dans les années 1980, souvent de manière grossière et dogmatique. Ces politiques étaient basées sur le soi-disant « consensus de Washington ». Avec ses règles non écrites, donnant la priorité à une croissance économique basée sur la dette privée avec une déréglementation et des impôts peu élevés sur les riches et les entreprises.

Comme je l’ai dit, la pandémie de coronavirus n’a fait qu’exacerber ces problèmes. L’année dernière, la chute de l’économie mondiale a été la plus importante depuis la Seconde Guerre mondiale. En juillet, les pertes sur le marché du travail équivalaient à près de 500 millions d’emplois. Oui, la moitié d’entre eux avaient été récupérés à la fin de l’année. Mais cela représente tout de même près de 250 millions d’emplois perdus. C’est un chiffre important et très alarmant. Rien qu’au cours des neuf premiers mois de l’année dernière, les pertes de revenus du travail dans le monde se sont élevées à 3,5 trillions de dollars. Et ce chiffre ne cesse de croître. Cela signifie que les tensions sociales sont en hausse.

Dans le même temps, la reprise après la crise n’est pas facile. Si, il y a 20 ou 30 ans, le problème pouvait être résolu en stimulant la politique macroéconomique (et c’est d’ailleurs ce qu’ils font encore), aujourd’hui, de tels mécanismes sont pratiquement épuisés, ils ne fonctionnent pas. Leurs ressources sont pratiquement épuisées. Ce n’est pas une affirmation infondée de ma part.

Ainsi, selon les estimations du FMI, le niveau de la dette agrégée des secteurs public et privé est proche de 200 % du PIB mondial. Et dans certaines économies, il a dépassé 300 % du PIB national. Pendant ce temps, les taux d’intérêt sont proches de zéro dans les économies développées. Et dans les principales économies émergentes, ils sont à des niveaux historiquement bas.

Tout cela rend la stimulation de l’économie par les outils traditionnels au détriment de l’augmentation des prêts privés pratiquement impossible. L’assouplissement dit quantitatif, qui ne fait qu’augmenter, gonfle la « bulle » de la valeur des actifs financiers et conduit à une stratification supplémentaire de la société. Et l’écart croissant entre l’économie « réelle » et « virtuelle » (d’ailleurs, j’en entends souvent parler par les représentants de l’économie réelle de nombreux pays, et je pense que les participants à la réunion d’aujourd’hui issus du monde des affaires seront également d’accord avec moi) est une menace réelle, porteuse de chocs graves et imprévisibles.

Certains espoirs de pouvoir « redémarrer » l’ancien modèle de croissance sont liés à la rapidité du développement technologique. En effet, les 20 dernières années ont jeté les bases de ce que l’on appelle la quatrième révolution industrielle, qui repose sur l’utilisation généralisée de l’intelligence artificielle, des solutions automatisées et de la robotique. La pandémie de coronavirus a considérablement accéléré ces développements et leur mise en œuvre.

Cependant, ce processus génère de nouveaux changements structurels, je pense tout d’abord au marché du travail. Cela signifie que sans une action gouvernementale efficace, de nombreuses personnes courent le risque d’être au chômage. Et c’est souvent ce qu’on appelle la classe moyenne. Or c’est la base de toute société moderne.

Et cela est lié au deuxième défi fondamental de la décennie à venir – le défi sociopolitique. La croissance des problèmes économiques et des inégalités divise la société, génère l’intolérance sociale, raciale et ethnique, et cette tension éclate même dans les pays dont les institutions civiles et démocratiques apparemment bien établies sont conçues pour aplanir et réprimer ces phénomènes et ces excès.

Les problèmes socio-économiques systémiques génèrent un tel mécontentement du public qu’ils nécessitent une attention particulière, qu’ils exigent que ces problèmes soient résolus de manière concrète. La dangereuse illusion qu’ils peuvent être ignorés, négligés, mis sur le côté est lourde de conséquences. Dans ce cas, la société sera toujours divisée, tant politiquement que socialement. Parce que pour les gens, les raisons d’être mécontents ne sont en fait pas des spéculations, mais de véritables problèmes qui concernent tout le monde, quelles que soient les opinions, y compris politiques, auxquelles on n’adhère. Ou auxquelles on pense tenir. Et ce sont les vrais problèmes qui génèrent le mécontentement.

Je voudrais souligner un autre point fondamental. Les géants technologiques modernes et, surtout, numériques ont commencé à jouer un rôle de plus en plus important dans la société. On en parle beaucoup aujourd’hui, notamment en relation avec les événements qui se sont déroulés aux États-Unis pendant la campagne électorale. Et ce ne sont plus des géants économiques quelconques ; dans certains domaines, ils sont en concurrence de facto avec les États. Leur audience se chiffre en milliards d’utilisateurs qui passent une partie importante de leur vie au sein de ces écosystèmes.

Du point de vue des entreprises elles-mêmes, leur position de monopole est optimale pour organiser les processus technologiques et commerciaux. C’est peut-être juste, mais le public se pose une question : dans quelle mesure un tel monopole correspond-il exactement à l’intérêt public ? Où se situe la limite entre le succès des entreprises mondiales, les services et les prestations demandés, la consolidation des données personnelles et les tentatives de gérer grossièrement, à sa guise, la société, de se substituer aux institutions démocratiques légitimes, en fait, d’usurper ou de limiter le droit naturel des gens à décider eux-mêmes comment vivre, quoi choisir, quelle position exprimer librement ? Nous l’avons tous vu récemment aux États-Unis, et tout le monde comprend ce dont je parle maintenant. Je suis sûr que la grande majorité des gens partagent cette position, y compris ceux qui participent à la conférence avec nous aujourd’hui.

Enfin, le troisième défi, ou plus précisément la menace évidente à laquelle nous pourrions être confrontés au cours de la prochaine décennie, est une nouvelle aggravation de l’ensemble des problèmes internationaux. Après tout, les problèmes socio-économiques intérieurs non résolus et croissants peuvent nous inciter à chercher un responsable pour tous les problèmes et à rediriger l’irritation et le mécontentement de nos citoyens. Et nous pouvons déjà le voir, nous pouvons sentir que le niveau de la politique étrangère, de la rhétorique de propagande augmente. Nous pouvons nous attendre à ce que la nature des actions concrètes devienne plus agressive, y compris la pression sur les pays qui ne sont pas d’accord avec le rôle de satellites obéissants et dirigés, l’utilisation de barrières commerciales, les sanctions illégitimes et les restrictions dans les sphères financières, technologiques et de l’information.

Ce jeu sans règles augmente de manière critique les risques d’utilisation unilatérale de la force militaire – c’est-à-dire le danger du recours à la force sous n’importe quel prétexte farfelu. Il multiplie la probabilité de nouveaux « points chauds » sur notre planète. C’est un tout qui ne peut que nous inquiéter.

Dans le même temps, chers participants au Forum, malgré un tel enchevêtrement de contradictions et de défis, nous ne devons certainement pas perdre notre vision positive de l’avenir et devons rester engagés dans un programme constructif. Il serait naïf de suggérer quelques remèdes miracles universels pour les problèmes évoqués. Mais nous devons tous essayer d’élaborer des approches communes, rapprocher nos positions le plus possible et identifier les sources de tensions mondiales.

Je voudrais répéter ma thèse : la cause fondamentale de l’insoutenabilité du développement mondial est, dans une large mesure, l’accumulation des problèmes socio-économiques. Par conséquent, la question clé aujourd’hui est de savoir comment élaborer la logique des actions afin non seulement de restaurer rapidement les économies et les secteurs mondiaux et nationaux touchés par la pandémie, mais aussi de garantir que cette restauration soit durable à long terme et ait une structure qualitative qui aide à surmonter le poids des déséquilibres sociaux. Il est clair que, compte tenu des contraintes de politique macroéconomique déjà mentionnées, la poursuite du développement économique dépendra davantage de la relance budgétaire, les budgets des gouvernements et les banques centrales jouant un rôle clé.

En fait, nous observons déjà de telles tendances dans les pays développés, et dans certains pays en développement également. Le rôle croissant des États dans la sphère socio-économique au niveau national exige évidemment une plus grande responsabilité et une coopération interétatique étroite sur l’agenda mondial également. Dans divers forums internationaux, on peut entendre des appels constants à une croissance inclusive, à la création de conditions permettant d’atteindre un niveau de vie digne pour chaque personne. C’est la bonne chose à faire, et notre travail commun va absolument dans la bonne direction.

Il est absolument clair que le monde ne peut pas s’engager sur la voie de la construction d’une économie qui fonctionne pour un million de personnes ou même un « milliard doré ». C’est tout simplement une position destructrice. Un tel modèle est par définition non viable. Les événements récents, notamment les crises migratoires, l’ont confirmé une fois de plus.

Il importe maintenant de passer d’une déclaration générale à l’action, de diriger les ressources et les efforts réels pour parvenir à la fois à la réduction des inégalités sociales au sein des différents pays et à la convergence progressive du niveau de développement économique des différents pays et régions de la planète. Il n’y aura alors pas de crise migratoire.

Le sens, l’importance d’une telle politique, destinée à assurer un développement durable et harmonieux, est évident. Qu’est-ce que c’est ? C’est la création de nouvelles opportunités pour chacun, des conditions pour le développement et la réalisation du potentiel humain, indépendamment de l’endroit où il est né et vit.

Et je vais ici présenter quatre grandes priorités. Pourquoi je les considère comme des priorités. Peut-être que je ne dirai rien d’original. Néanmoins, puisque Klaus m’a permis d’exprimer la position de la Russie, ma position, je le ferai volontiers.

Premièrement. Une personne doit avoir un environnement de vie confortable. Il s’agit du logement et des infrastructures accessibles : transport, énergie, services publics. Et, bien sûr, le bien-être environnemental, il ne doit jamais être oublié.

Deuxièmement. Une personne doit être sûre qu’elle aura un emploi, qui lui procurera un revenu en constante augmentation et, par conséquent, un niveau de vie décent. Elle devrait avoir accès à des mécanismes efficaces d’apprentissage tout au long de la vie, aujourd’hui c’est absolument nécessaire, lui permettant de développer et de construire sa carrière, et après son achèvement d’obtenir une retraite et un paquet social décents.

Troisièmement. Une personne doit être sûre qu’elle recevra des soins médicaux efficaces et de qualité lorsqu’elle en aura besoin, que le système de soins de santé lui garantit en tout cas l’accès à un niveau moderne de services.

Quatrièmement. Quel que soit le revenu familial, les enfants doivent avoir la possibilité de recevoir une éducation décente et de réaliser leur potentiel. Chaque enfant a ce potentiel.

C’est la seule façon de garantir le développement le plus efficace de l’économie moderne. Une économie où l’homme n’est pas un moyen, mais un but. Et seuls les pays qui pourront progresser dans ces quatre domaines (ils ne sont pas exhaustifs, je n’ai dit que l’essentiel), mais seuls les pays qui pourront progresser au moins dans ces quatre domaines, assureront un développement durable et inclusif.

Ce sont les approches qui sont au cœur de la stratégie que mon pays, la Russie, met également en œuvre. Nos priorités s’articulent autour de l’individu, de sa famille, et visent le développement démographique et la préservation de la nation, l’amélioration du bien-être des personnes et la protection de leur santé. Nous nous efforçons de créer les conditions d’un travail digne et efficace et d’un entrepreneuriat réussi, afin d’assurer la transformation numérique comme base du mode technologique de l’avenir de tout le pays, plutôt que d’un groupe étroit d’entreprises.

Nous voulons concentrer les efforts du gouvernement, des entreprises et de la société civile sur ces tâches et mettre en place une politique budgétaire stimulante dans les années à venir.

Nous sommes ouverts à la coopération internationale la plus large possible pour atteindre nos objectifs nationaux de développement et nous pensons qu’une coopération sur l’agenda socio-économique mondial aurait un impact positif sur l’atmosphère générale des affaires mondiales également, tandis qu’une interdépendance dans le traitement des questions urgentes acttuelles ajouterait à la confiance mutuelle, ce qui est particulièrement important et urgent de nos jours.

De toute évidence, l’ère associée aux tentatives de construction d’un ordre mondial centralisé et unipolaire, cette époque est révolue. En fait, elle n’a même pas encore commencé. Seule une tentative a été faite dans ce sens. Mais cela aussi est passé. Un tel monopole était tout simplement intrinsèquement contraire à la diversité culturelle et historique de notre civilisation.

La réalité est que différents pôles de développement avec leurs propres modèles originaux, systèmes politiques et institutions sociales ont émergé dans le monde et se sont fait connaître. Et aujourd’hui, il est extrêmement important de construire des mécanismes de coordination de leurs intérêts, afin que la diversité et la concurrence naturelle des pôles de développement ne se transforment pas en anarchie et en une série de conflits prolongés.

À cette fin, nous devons notamment travailler au renforcement et au développement des institutions universelles qui ont une responsabilité particulière pour assurer la stabilité et la sécurité dans le monde et pour élaborer les règles de conduite de l’économie mondiale et du commerce.

J’ai déjà déclaré plus d’une fois que beaucoup de ces institutions traversent des moments difficiles. Nous en parlons constamment lors de différents sommets. Bien sûr, ces institutions ont été créées à une autre époque, c’est clair. Il peut être objectivement difficile pour elles de relever les défis d’aujourd’hui. Toutefois, je voudrais souligner que ce n’est pas une raison pour les rejeter, sans rien offrir à la place. D’autant plus que ces structures ont une expérience unique et un grand potentiel, largement inexploité. Il ne fait aucun doute qu’elles doivent être soigneusement adaptées aux réalités actuelles. Mais il est encore trop tôt pour les jeter à la poubelle de l’histoire. Nous devons travailler avec elles et les utiliser.

Parallèlement, il est bien sûr important d’utiliser des formats d’interaction nouveaux et supplémentaires. Je fais ici référence au phénomène du multilatéralisme. Bien sûr, il peut aussi être compris de différentes manières. Il peut s’agir soit de faire valoir ses intérêts, en donnant un semblant de légitimité aux actions unilatérales alors que les autres n’ont qu’à hocher la tête pour approuver. Ou bien il s’agit d’une véritable unification des efforts des États souverains pour résoudre des problèmes spécifiques dans l’intérêt commun. Dans ce cas, nous pouvons parler du règlement des conflits régionaux, de la création d’alliances technologiques et de nombreux autres domaines, y compris la formation de couloirs transfrontaliers de transport et d’énergie, etc.

Chers amis, Mesdames et Messieurs !

Vous comprenez qu’il existe un vaste champ de travail commun. De telles approches multilatérales fonctionnent vraiment. La pratique montre qu’elles fonctionnent. Permettez-moi de vous rappeler que dans le cadre du format Astana, la Russie, l’Iran et la Turquie font beaucoup pour stabiliser la situation en Syrie et aident maintenant à établir un dialogue politique en Syrie. Bien sûr, avec d’autres pays. Nous le faisons ensemble. Et ce n’est généralement pas sans succès, je tiens à le souligner.

Par exemple, la Russie a entrepris des efforts de médiation actifs pour mettre fin au conflit armé dans la région du Haut-Karabakh, dans lequel les peuples et les États proches de nous – l’Azerbaïdjan et l’Arménie – ont été impliqués. Dans le même temps, nous avons cherché à suivre les principaux accords conclus au sein du groupe de Minsk de l’OSCE, en particulier entre ses coprésidents – la Russie, les États-Unis et la France. C’est également un très bon exemple de coopération.

Comme vous le savez, une déclaration trilatérale entre la Russie, l’Azerbaïdjan et l’Arménie a été signée en novembre. Et il est important qu’elle soit, dans l’ensemble, mise en œuvre de manière cohérente. Nous avons réussi à arrêter le bain de sang. C’est la chose la plus importante. Nous avons réussi à arrêter l’effusion de sang, à obtenir un cessez-le-feu complet et à entamer le processus de stabilisation.

La communauté internationale et, sans aucun doute, les pays impliqués dans la résolution de la crise doivent maintenant aider les zones touchées à relever les défis humanitaires que sont le retour des réfugiés, la reconstruction des infrastructures détruites et la protection et la restauration des monuments historiques, religieux et culturels.

Ou un autre exemple. Je voudrais souligner le rôle de la Russie, de l’Arabie saoudite, des États-Unis et d’un certain nombre d’autres pays dans la stabilisation du marché mondial de l’énergie. Ce format est devenu un exemple productif d’interaction entre des pays ayant des points de vue différents, parfois même complètement opposés, sur les processus mondiaux et leurs propres visions du monde.

Dans le même temps, bien sûr, il y a des problèmes qui concernent tous les États sans exception. La coopération dans l’étude et le contrôle de la pandémie de coronavirus en est un exemple. Récemment, plusieurs variantes de ce que l’on sait être une maladie dangereuse ont fait leur apparition. Et la communauté internationale doit créer les conditions permettant aux scientifiques et aux spécialistes de travailler ensemble pour comprendre pourquoi et comment les mutations du coronavirus se produisent et comment les différentes souches diffèrent les unes des autres. Et bien sûr, nous devons coordonner les efforts du monde entier, comme l’a demandé le secrétaire général de l’ONU et comme nous l’avons demandé lors du sommet du G20 il n’y a pas si longtemps, afin d’unir et de coordonner les efforts du monde entier pour lutter contre la propagation de la maladie et accroître la disponibilité des vaccins contre le coronavirus dont nous avons tant besoin. Nous devons aider les nations qui ont besoin de soutien, y compris les nations africaines. Je parle de l’intensification des tests et de la vaccination. Nous constatons que la vaccination de masse est désormais accessible principalement aux citoyens des pays développés. Alors que des centaines de millions de personnes dans le monde n’ont même pas l’espoir de bénéficier d’une telle protection. Dans la pratique, cette disparité peut représenter une menace générale, car, comme on le sait et comme on l’a dit à maintes reprises, l’épidémie continuera à se prolonger et des poches incontrôlables persisteront. Elle n’a pas de frontières.

Il n’y a pas de frontières pour les infections et les pandémies. Nous devons donc tirer les leçons de la situation actuelle et proposer des mesures visant à accroître l’efficacité du système de surveillance de l’apparition de ces maladies dans le monde et de l’évolution de ces situations.

Un autre domaine important dans lequel nous devons coordonner notre travail, voire celui de la communauté internationale dans son ensemble, est la protection du climat et de la nature de notre planète. Je ne vais rien dire de nouveau ici non plus.

Ce n’est qu’ensemble que nous pourrons progresser dans la résolution de problèmes aussi graves que le réchauffement climatique, la déforestation, la perte de biodiversité, l’augmentation des déchets, la pollution des océans par les plastiques, etc, et trouver le meilleur équilibre entre les intérêts du développement économique et la préservation de l’environnement pour les générations actuelles et futures.

Chers participants du forum ! Chers amis !

Nous savons tous que la concurrence, la rivalité entre les pays dans l’histoire du monde n’a pas cessé, ne cesse pas et ne cessera jamais. En fait, les divergences et les conflits d’intérêts sont aussi une chose naturelle pour un organisme aussi complexe que la civilisation humaine. Toutefois, à des moments critiques, cela ne nous a pas empêchés, mais au contraire, nous a encouragés à unir nos efforts dans les directions les plus importantes et les plus décisives. Et il me semble que nous vivons précisément une telle époque.

Il est très important d’évaluer honnêtement la situation, de se concentrer non pas sur des problèmes mondiaux imaginaires mais bien réels, d’éliminer les déséquilibres qui sont d’une importance capitale pour l’ensemble de la communauté internationale. Et alors, j’en suis sûr, nous pourrons réussir, relever les défis de la troisième décennie du XXIe siècle avec dignité.

J’aimerais terminer ici et vous remercier pour votre patience et votre attention.

Merci beaucoup.

Vladimir Poutine

Source

Traduction par Christelle Néant pour Donbass Insider

Vu ici

Partager cet article
Repost0
31 janvier 2021 7 31 /01 /janvier /2021 19:38

C'est à la fois terrible et fascinant : autant d'égo surdimensionné dans un seul homme. Non seulement il en est infusé mais il le diffuse, tout en démontrant avec certitude que le monde de demain ouvre ses jambes bleues aux futurs élites dirigeantes, le reste, ç'est à dire selon lui (Laurent Alexandre directeur de Doctissimo et chirurgien) les êtres inutiles seront substituables a merci à moins que l'intelligence artificielle ne leur développe leurs capacités intellectuelles. Ce qui veut également dire que l'homme sera lié intrinsèquement  à la machine comme le propose et l'appelle de ses voeux Klaus Schawb directeur du Forum économique Mondial.

C'est donc un apôtre de ce nouvel évangile que je qualifierai de démoniaque puisqu'il érige en statut de dieu (ç'est lui qui le dit évidemment)  les élites impliquées dans le processus et rejette la majorité dans une sorte de fange innommable inconséquente et servile à souhait.

Voilà donc la vision des abysses auquel il voue la majorité pour s'auto délecté de sa suffisance et de la vanité de son savoir sans conscience

Partager cet article
Repost0
31 janvier 2021 7 31 /01 /janvier /2021 19:33

Le texte que je partage ici avec vous grâce à la bienveillance de son auteur, m'a transpercé et ébloui. Comme je lui ai écrit, j'ai mis plusieurs heures à me remettre de sa lecture.
https://s2.qwant.com/thumbr/0x380/7/9/19804e8ef1d90709fb7f165faefdd2bef37671e3b3c5be3d173d01d2ed370b/cle_mafia.jpg?u=http%3A%2F%2Fshekoos.files.wordpress.com%2F2011%2F05%2Fcle_mafia.jpg&q=0&b=1&p=0&a=1
© Inconnu
Dieu sait pourtant si l'époque, dans sa folie, a été propice à susciter des réflexions et de mises en perspectives de qualité, dont j'ai eu l'honneur de re-publier un petit nombre sur ce blog. Et puis il y a des textes, parfois, d'une clarté qui atteint à l'incandescence, portés par un souffle rare, qui illuminent le champ de vision du lecteur. Celui-ci est de ceux-ci.

Il me faudrait des pages pour présenter Michel Maffesoli, un des tout grands penseurs de notre époque. Professeur émérite à la Sorbonne, il s'est inscrit dans un héritage somptueux (allant pour faire vite de Gaston Bachelard à Gilbert Durand, le défricheur lumineux des « structures anthropologiques de l'imaginaire », en passant par Jean Duvignaud, Georges Bataille, Julien Freund ou encore Georges Ballandier), produisant un renouvellement audacieux de la pratique socio-anthropologique et nourrissant une féconde descendance intellectuelle.

Dans laquelle j'ai l'heur de m'inscrire modestement puisque mon directeur de mémoire en anthropologie était au double bénéfice d'un doctorat en anthropologie (sous la direction de Gilbert Durand) et d'un doctorat d'État en Sorbonne (sous celle précisément de Michel Maffesoli.)

Celui-ci aborde ici un thème qu'il a abondamment défriché, de manière visionnaire, bien avant que qui que ce soit s'en préoccupe sérieusement : celui de la faillite des élites. Nous devons à Maffesoli des concepts essentiels pour comprendre l'effondrement de la modernité dans lequel nous nous trouvons engagés comme ceux de « tribalisme », de « nomadisme », d'« ensauvagement » ou encore d'« infosphère ».

Il me tient à cœur de partager, aussi, sur ce blog des perspectives épistémologiques, essentielles pour appréhender ce qui sur-détermine le désastre en cours. Je m'y suis essayé dans différents articles, accueillant au passage des productions magnifiques comme celles de l'anthropologue Jacques Pollini, du sociologue Laurent Mucchielli, du philosophe Michel Weber, du psychanalyste Michel Rosenzweig, sans oublier celles de différents médecins, chercheurs ou psychiatres.

Je ne développerai pas ici l'immensité des contributions de Bachelard, Durand et Maffesoli au domaine de l'épistémologie, si ce n'est pour en rappeler un socle dont la négation se trouve bel et bien au cœur du naufrage en cours : toute la production de sens de notre espèce est configurée selon certains axes symboliques fondamentaux. Ce que l'on définit aujourd'hui comme « la science » résultant (simplement osera-t-on dire) d'une polarisation particulière du champ des images. Assurément légitime, mais aussi inéluctablement limitée.

C'est un des phénomènes saisissants de notre époque que la généralisation des renversements, indiquant que la crise est en fait bien plus « religieuse » que sanitaire, politique ou même socio-économique. Nous vivons ainsi un état confusionnel collectif - tragique et à haut risque - qui voit les axes cardinaux de l'absolu et du relatif être désorientés : la science, qui est un savoir relatif et circonstanciel, se substitue à la religion comme absolu, alors même que la caste qui s'en réclame la prostitue de toutes les manières possibles et imaginables. Une épidémie naturelle, normale et à vrai dire « banale » au regard de l'histoire devient un cataclysme absolu !

Dans le même temps, l'Absolu lui-même (dont la juste contemplation constitue notre seul véritable garde-fou en ce qu'il nous rappelle implacablement notre condition de créatures inscrites au sein d'une création) se trouve relativisé sous les coups de boutoir psychotiques du délire transhumaniste : les milliardaires de la Silicon Valley aspirent à l'immortalité, et imposent la « correction » et l'« amélioration » du vivant à coups de manipulations génétiques.

Les parlements nationaux (qui n'ont plus de nationaux que le nom, réduit à un simple prétexte) embouchent ces trompettes apocalyptiques : l'interruption de grossesse est désormais possible en France sans raison médicale impérative jusqu'au terme de la grossesse (« horresco referens ») pendant que le tabou éthique posé sur la création de chimères (embryons mi-humains mi-animaux) a été remisé aux oubliettes, ouvrant la porte aux pires monstruosités selon le modèle chinois - qui a déjà produit des êtres humains « clonés »...

Le texte de Michel Maffesoli percute la sensibilité et l'intelligence de plein fouet, la particularité de l'auteur étant de pratiquer une sociologie incarnée, polysémique, qui se différencie de manière assumée d'une sociologie plus « rationnelle » et cérébrale.

Il y aborde un des nœuds centraux de l'affaire qui nous occupe tous à nos corps défendant : celui de la faillite mais aussi de l'ensauvagement des élites. Nos gouvernants se comportent désormais sans le moindre scrupule apparent comme des malfrats, mentant à tout va, niant les évidences, considérant n'avoir plus de compte à rendre à qui que ce soit, imposant des mesures arbitraires et brutales à leur guise, en s'exonérant d'un même mouvement de tout devoir de conformation au réel comme de leur responsabilité envers l'intérêt supérieur des peuples qu'ils sont censés servir.

Dans un récent entretien avec André Bercoff, Michel Maffesoli exprimait sa certitude que cet état de fait ne pourrait que déboucher sur des explosions de violence, chaotiques, incontrôlables et fugaces. Nous en prenons le chemin à grand pas, les contre-pouvoirs devant faire barrage à l'hubris débridé et existentiellement blasphématoire de nos élites étant désormais structurellement aux abonnés absents.

C'est avec une très chaleureuse et révérante gratitude que je remercie Michel Maffesoli de l'autorisation qu'il m'a donnée de partager son texte (publié sur le site du Courrier des stratèges) avec les lectrices et lecteurs de ce blog.

Il met le doigt, avec le génie qui est le sien, exactement là où ça fait mal, soit là où notre lucidité (ou ce qu'il en reste) doit impérativement regarder si nous voulons préserver une chance de sortir tôt ou tard du délire en cours...

* * * * * * * * * * * * * * * *

« Une société en pleine décadence », par Michel Maffesoli, Professeur émérite à la Sorbonne

Michel Maffesoli nous livre un texte direct et panoramique sur la décadence de notre société que suscitent nos élites. À force d'être obsédées par la morale et par une étiquette de cour, ces élites se sont détournées de flux du vivant et entretiennent une vision artificielle de la société dont le seul destin est de disparaître.

S'accorder au cycle même du monde, voilà ce qui est la profonde sagesse des sociétés équilibrées. Tout comme, d'ailleurs, de tout un chacun. C'est cela même qui fonde le sens de la mesure. Le « bon sens » qui, selon Descartes, est la chose du monde la mieux partagée. Bon sens qui semble perdu de nos jours. Tout simplement parce que l'opinion publiée est totalement déconnectée de l'opinion publique.

Mais pour un temps, sera-t-il long ? Cette déconnection est quelque peu masquée. C'est la conséquence d'une structure anthropologique fort ancienne : la stratégie de la peur.
Note de Sott : Le lecteur notera les similitudes avec le concept de pseudo-réalité développé par Andrew Lobaczewski dans son ouvrage La ponérologie politique et James Lindsay, notamment dans son article traduit en français et publié par Sott « La psychopathie et les origines du totalitarisme », mais aussi dans son livre co-écrit avec Helen Pluckrose, Cynical Theories [« Théories cyniques », non traduit en français]. Les mises en gras sont de notre fait.
* * * * * * * * * * * * * * * *

La stratégie de la peur pour se maintenir au pouvoir

D'antique mémoire, c'est en menaçant des supplices éternels de l'enfer que le pouvoir clérical s'est imposé tout au long du Moyen-Âge. Le protestantisme a, par après, fait reposer « l'esprit du capitalisme » (Max Weber) sur la théologie de la « prédestination ». Vérifier le choix de dieu : être élu ou damné aboutit à consacrer la « valeur travail ». L'économie du salut aboutit ainsi à l'économie stricto sensu !

Dans la décadence en cours des valeurs modernes, dont celle du travail et d'une conception simplement quantitativiste de la vie, c'est en surjouant la peur de la maladie que l'oligarchie médiatico-politique entend se maintenir au pouvoir. La peur de la pandémie aboutissant à une psycho-pandémie d'inquiétante allure.

Comme ceux étant censés gérer l'Enfer ou le Salut, la mise en place d'un « Haut commissariat au Bonheur » n'a, de fait, pour seul but que l'asservissement du peuple. C'est cela la « violence totalitaire » du pouvoir : la protection demande la soumission ; la santé de l'âme ou du corps n'étant dès lors qu'un simple prétexte.

Le spectre eugéniste, l'aseptie de la société, le risque zéro sont des bons moyens pour empêcher de risquer sa vie. C'est-à-dire tout simplement de vivre ! Mais vivre, n'est-ce pas accepter la finitude ? Voilà bien ce que ne veulent pas admettre ceux qui sont atteints par le « virus du bien ». Pour utiliser une judicieuse métaphore de Nietzsche, leur « moraline » est dès lors on ne peut plus dangereuse pour la vie sociale, pour la vie tout court !

La morale comme instrument de domination

Étant entendu, mais cela on le savait de longue date, que la morale est de pure forme. C'est un instrument de domination. Quelques faits divers contemporains, animant le Landernau germanopratin montrent, à loisir que tout comme le disait le vieux Marx, à propos de la bourgeoisie, l'oligarchie « n'a pas de morale, elle se sert de la morale ».

Le moralisme fonctionne toujours selon une logique du « devoir-être », ce que doivent être le monde, la société, l'individu et non selon ce que ces entités sont en réalité, dans leur vie quotidienne. C'est cela même qui fait que dans les « nuées » qui sont les leurs, les élites déphasées ne savent pas, ne veulent pas voir l'aspect archétypal de la finitude humaine. Finitude que les sociétés équilibrées ont su gérer.

C'est cela le « cycle du monde ». Mors et vita ! Le cycle même de la nature : si le grain ne meurt... Qu'est-ce à dire, sinon que la beauté du monde naît, justement, de l'humus ; du fumier sur lequel poussent les plus belles fleurs. Régle universelle faisant de la souffrance et de la mort des gages d'avenir.

En bref, les pensées et les actions de la vie vivante sont celles sachant intégrer la finitude consubstantielle à l'humaine nature. À la nature tout court, mais cela nous oblige à admettre qu'à l'opposé d'une histoire « progressiste » dépassant, dialectiquement, le mal, la dysfonction et pourquoi pas la mort, il faut s'accommoder d'un destin autrement tragique, où l'aléa, l'aventure le risque occupent une place de choix.

Pour une philosophie progressive

Et au-delà du rationalisme progressiste, c'est bien de cette philosophie progressive dont est pétrie la sagesse populaire. Sagesse que la stratégie de la peur du microcosme ne cesse de s'employer à dénier. Et ce en mettant en œuvre ce que Bergson nommait « l'intelligence corrompue », c'est-à-dire purement et simplement rationaliste.

Ainsi le funambulisme du microcosme s'emploie-t-il pour perdurer à créer une masse infimie de zombies. Des morts-vivants, perdant, peu à peu, le goût doux et âcre à la fois de l'existence. Par la mascarade généralisée, le fait de se percevoir comme un fantôme devient réel. Dès lors, c'est le réel qui, à son tour, devient fantomatique.

Monde fantomatique que l'on va s'employer à analyser d'une manière non moins fantomatique. Ainsi, à défaut de savoir « déchiffrer » le sens profond d'une époque, la modernité, qui s'achève, et à défaut de comprendre la postmodernité en gestation, l'on compose des discours on ne peut plus frivoles. Frivolités farcies de chiffres anodins et abstraits.

Il est, à cet égard, frappant de voir fleurir une quantophrénie ayant l'indubitabilité de la Vérité ! Carl Schmidt ou Karl Löwith ont, chacun à leur manière, rappelé que les concepts dont se servent les analyses politiques ne sont que des concepts théologiques sécularisés.

La dogmatique théologique propre à la gestion de l'Enfer ou la dogmatique progressiste théorisant la « valeur travail » s'inversent en « scientisme » prétendant dire ce qu'est la vérité d'une crise civilisationnelle réduite en crise sanitaire. « Scientisme », car le culte de la science est omniprésent dans les divers discours propres à la bien-pensance.

Cet étrange culte de la science

Il est frappant d'observer que les mots ou expressions, science, scientifique, comité scientifique, faire confiance à la Science et autres de la même eau sont comme autant de sésames ouvrant au savoir universel. La Science est la formule magique par laquelle les pouvoirs bureaucratiques et médiatiques sont garants de l'organisation positive de l'ordre social. Il n'est jusqu'aux réseaux sociaux, Facebook, Tweeter, Lindkedin, qui censurent les internautes qui « ne respectent pas les règles scientifiques », c'est-à-dire qui ont une interprétation différente de la réalité. Doute et originalité qui sont les racines de tout « progrès » scientifique !

Oubliant, comme l'avait bien montré Gaston Bachelard que les paradoxes d'aujourd'hui deviennent les paradigmes de demain, ce qui est le propre d'une science authentique alliant l'intuition et l'argumentation, le sensible et la raison, le microcosme se contente d'un « décor » scientiste propre à l'affairement désordonné qui est le sien.

Démocrates, peut-être, mais démophiles, certainement pas

Politiques, journalistes, experts pérorant jusqu'à plus soif sont en effet, à leur « affaire » : instruire et diriger le peuple, fût-ce contre le peuple lui-même. Tant il est vrai que les démocrates auto-proclamés sont très peu démophiles. Au nom de ce qu'ils nomment la Science, ils vont taxer de populistes, rassuristes voire de complotistes tous ceux qui n'adhèrent pas à leurs lieux communs.

On peut d'ailleurs leur retourner le compliment. Il suffit d'entendre, pour ceux qui en ont encore le courage, leur lancinante loggorhée, pour se demander si ce ne sont pas eux, les chasseurs de fake news, qui sont les protagonistes essentiels d'une authentique « complosphère »[1]. Très précisément parce qu'ils se contentent de mettre le monde en spectacle.

Pour reprendre le mot de Platon, décrivant la dégénérescence de la démocratie, la « Théâtrocratie » est leur lot commun. Politique spectacle des divers politiciens, simulacre intellectuel des experts de pacotille et innombrables banalités des journalistes servant la soupe aux premiers, tels sont les éléments majeurs constituant le tintamarre propre à ce que l'on peut nommer la médiocrité de la médiacratie.

Face à l'inquisition de l'infosphère

J'ai qualifié ce tintamarre « d'infosphère ». Nouvelle inquisition, celle d'une élite déphasée regardant « de travers » tout à la fois le peuple malséant et tous ceux n'adhérant pas au catéchisme de la bienpensance. « Regarder de travers », c'est considérer ceux et ce que l'on regarde en coin comme étant particulièrement dangereux. Et, en effet, le peuple est dangereux. Ils ne sont pas moins dangereux tous ceux n'arrivant pas à prendre au sérieux la farce sanitaire mise en scène par les théâtrocrates au pouvoir.

Il faudrait la plume d'un Molière pour décrire, avec finesse, leurs arrogantes tartufferies. Leur pharisianisme visant à conforter la peur, peut aller jusqu'à susciter la délation, la dénonciation de ceux ne respectant pas la mise à distance de l'autre, ou de ceux refusant de participer au bal masqué dominant. Leur jésuitisme peut également favoriser la conspiration du silence vis-à-vis du mécréant. (celui qui met en doute La Science). Et parfois même aller jusqu'à leur éviction pure et simple des réseaux sociaux.

Dans tous ces cas, il s'agit bien de la reviviscence inquisitoriale. La mise à l'Index : Index librorum prohibitorum. Délation et interdiction selon l'habituelle manière de l'inquisition : au moyen de procédures secrètes. L'entre-soi est l'élément déterminant de la tartufferie médiatico-politique. L'omerta mafieuse : loi du silence, faux témoignages, informations tronquées, demi-vérités, sournoiseries etc. Voilà bien le modus operandi de la fourberie en cours. Et tout un chacun peut compléter la liste de ces parades théâtrales.

Voilà les caractéristiques essentielles de « l'infosphère », véritable complosphère dominante. Mafia, selon la définition que j'ai proposée des élites, rassemblant « ceux qui ont le pouvoir de dire et de faire ». Puis-je ici rappeler, à nouveau, une rude expression de Joseph de Maistre pour décrire ceux qui sont abstraits de la vie réelle : « la canaille mondaine ».

Peut-être faudrait-il même dire « demi-mondaine ». Ce qui désigne, selon Alexandre Dumas, une « cocotte » richement entretenue et se manifestant bruyamment dans la sphère médiatique, le théâtre et la vie publique ou politique. Demi-monde on ne peut plus nébuleux dont les principales actions sont de déformer la réalité afin de la faire rentrer en congruence avec leur propre discours. Demi-mondaines entretenues par l'État ou les puissances financières de la démocratie afin de faire perdurer un état de choses désuet et rétrograde.

Mais cette déformation de la réalité a, peu à peu, contaminé l'espace public.

C'est cela le cœur battant du complotisme de « l'infosphère » : entretenir « mondainement » la peur de l'enfer contemporain. Anxiété, restriction des libertés acceptée, couardise, angoisse diffuse et tout à l'avenant au nom du « tout sanitaire ». Forme contemporaine du « tout à l'égoût » !

Une vraie psycho-pandémie

Sans nier la réalité et l'importance du virus stricto sensu, sans négliger le fait qu'il ait pu provoquer un nombre non négligeable de décès, ce qui n'est pas de ma compétence, il faut noter que le « virus » s'est introduit de manière essentielle dans nos têtes. Ce qui devrait nous conduite à parler d'une « psycho-pandémie » suscitée et entretenue par l'oligarchie médiatico-politique.

Psycho-pandémie comme étant la conséquence logique de ce que Heidegger nomme la « pensée calculante » qui, obnubilée par le chiffre et le quantitatif et fascinée par une logique abstraite du « devoir être », oublie la longue rumination de la « pensée méditante » qui, elle, sait s'accorder, tant bien que mal à la nécessité de la finitude.

Voilà ce qui, pour l'immédiat suscite une sorte d'auto-anéantissement ou d'auto-aliénation conduisant à ce que ce bel esprit qu'était La Boétie nommait la « servitude volontaire ». Ce qui est, sur la longue durée des histoires humaines, un phénomène récurrent. Cause et effet de la stratégie de la peur qui est l'instrument privilégié de tout pouvoir, quel qu'il soit.

Stratégie de la peur qui, au-delà ou en-deçà de l'idéal communautaire sur lequel se fonde tout être ensemble, aboutit, immanquablement à une grégaire solitude aux conséquences on ne peut plus dramatique : violence perverse, décadence des valeurs culturelles, perte du sens commun et diverses dépressions collectives et individuelles. L'actualité n'est pas avare d'exemples illustrant une telle auto-aliénation !

Il est deux expressions qui devraient nourrir la pensée méditante, ce que Durkheim nomme le « conformisme logique », ou ce que Gabriel Tarde analyse dans « les lois de l'imitation ». Des insanités déversées d'une manière lancinante, dans la presse écrite, radiophonique ou télévisuelle par l'oligarchie, au spectacle du bal masqué que nous offre la réalité quotidienne, on voit comment la stratégie de la peur induite par l'inquisition contemporaine aboutit à un état d'esprit tout à fait délétère, et on ne peut plus dangereux pour toute vie sociale équilibrée.

Cette grégaire solitude est particulièrement angoissante pour les jeunes générations auxquelles est déniée tout apprentissage vital. Et c'est pour protéger des générations en fin de vie que l'on sacrifie une jeunesse qui est, ne l'oublions pas, la garante de la société à venir.

De diverses manières de bons esprits ont rappelé qu'une société prête à sacrifier la liberté, la joie de vivre, l'élan vital en échange de sécurité et de tranquillité ne mérite ni les uns, ni les autres. Et, in fine, elle perd le tout. N'est-ce point cela qui menace, actuellement, la vie sociale en son ensemble ?

De la raison sensible

Mais une fois le diagnostic fait, il est nécessaire de formuler un pronostic pertinent. Ainsi, en accord avec le réalisme que l'on doit à Aristote ou à Saint Thomas d'Aquin, il faut savoir mettre en oeuvre un chemin de pensée alliant les sens et l'esprit. Ce que j'ai nommé la « raison sensible ».

Voilà qui peut mettre à bas les châteaux de cartes du rationalisme étroit dans lequel les concepts abstraits servent de pseudo-arguments. Le bon sens et la droite raison réunis peuvent permettre de mettre un terme au brouhaha des mots creux. C'est bien d'ailleurs ce qui est en train de se passer sur les réseaux sociaux dans lesquels grâce aux tweets, forums de discussion, échanges sur Facebook, sites et blogs de résistance divers et presse en ligne est en train de s'élaborer une manière de penser et d'agir différente. Il faut être attentif à la société officieuse en gestation, totalement étrangère à la société officielle propre à l'oligarchie médiatico-politique.

Il est une heureuse expression que l'on doit à l'universitaire et homme politique Pierre-Paul Royer-Collard (1763 - 1845) qu'il est utile de rappeler de nos jours. C'est ainsi qu'il oppose « le pays légal au pays réel ». Par après cette opposition a été reprise, diversement, par Auguste Comte ou Charles Maurras. Mais elle a l'heur de nous rappeler que parfois, il existe un divorce flagrant qui oppose la puissance populaire, puissance instituante, au pouvoir officiel et institué. C'est ce qui permet de saisir la lumière intérieure du bon sens populaire. C'est ce qui permet de comprendre qu'au-delà de la décomposition d'une société peut exister une renaissance. C'est cette métamorphose qui est en cours. Et au-delà de la soumission induite par la protection, c'est dans le « pays réel » que se préparent les soulèvements fondateurs d'une autre manière d 'être ensemble.

Ainsi de la révolte des « gilets jaunes » à la résistance, multiforme, à la mascarade, à la distanciation, voire aux vaccins, c'est une métamorphose sociétale qui se prépare. Le « monde d'après » est déjà là. Métamorphose qui bien évidemment à ce que Vilfredo Pareto nommait, avec pertinence, la « circulation des élites ».

La faillite des élites est déjà là

Une telle circulation est inéluctable. La faillite des élites est, maintenant, chose acquise. La forte abstention aux diverses élections, la désaffection vis-à-vis des organes de presse, émissions de télévision ou radio en portent témoignage. Ce que l'on peut appeler « des bulletins paroissiaux » n'intéresse que des affidés, des petites sectes médiatico-politiques se partageant le pouvoir.

Or le propre des « sectaires » est, en général, d'être totalement aveugles vis-à-vis de ce qui échappe à leur dogmatique. C'est ainsi que tout en considérant cela comme dangereux, ils sont incapables de repérer et de comprendre ces indices hautement significatifs que sont les rassemblements festifs se multipliant un peu partout. Il en est de même des multiples transgressions aux divers « confinements » et autres « couvre-feu » promulgués par l'appareil technico-bureaucratique. Et l'on pourrait multiplier à loisir des exemples en ce sens.

Lorsque dans les années 70, je soulignais que la vraie violence, la « violence totalitaire » était celle d'une « bureaucratie céleste » voulant aseptiser la vie sociale et ce en promulguant la nécessité du risque zéro, je rappelais qu'à côté d'une soumission apparente existaient une multiplicité de pratiques rusées. Expression d'une duplicité structurelle : être tout à la fois double et duple.

Il s'agit là d'un quant à soi populaire assurant, sur la longue durée, la survie de l'espèce et le maintien de tout être ensemble. C'est bien un tel « quant à soi » auquel l'on rend attentif tout au long de ces pages. Il témoigne d'une insurrection larvée dont la tradition donne de nombreux exemples et qui ponctue régulièrement l'histoire humaine.

Duplicité anthropologique de ce bon sens dont Descartes a bien montré l'importance. Duplicité qui à l'image de ce qu'il disait : « larvatus prodeo », l'on s'avance masqué dans le théâtre du monde. Mais il s'agit là d'un masque provisoire qui sera, plus ou moins brutalement, ôté lorsque le temps s'y prêtera. Et ce en fonction du vitalisme populaire qui sait, de savoir incorporé, quand il convient de se soulever. Et ce avant que le bal masqué ne s'achève en danse macabre !
Note

[1] Je renvoie ici à la lucide et sereine analyse de Raphaël Josset, Complosphère. L'esprit conspirationniste à l'ère des réseaux, Lemieux éditeurs, 2015
Source du texte écrit par Michel Maffesoli, Professeur émérite à la Sorbonne, et publié le 22 janvier 2021 : Le courrier des Stratèges
Source de l'article : Jean-Dominique Michel sur Anthropo-logiques
Partager cet article
Repost0
31 janvier 2021 7 31 /01 /janvier /2021 19:08
 
Une coalition de grandes entreprises technologiques, dont Microsoft, est en train de mettre au point un passeport COVID, en espérant qu’un document numérique lié au statut de vaccination sera nécessaire pour voyager et accéder aux services de base.

 

 

Le groupe se nomme lui-même «Vaccination Credential Initiative» (VCI) et comprend Microsoft, Salesforce et Oracle.

Le prestataire de santé américain Mayo Clinic participe également au projet, qui est décrit comme «l’effort de vaccination le plus important de l’histoire des États-Unis».

L’idée est désormais familière. Toute personne ayant été vaccinée recevra un code QR qui pourra être stocké sur son téléphone portable dans l’application de portefeuille. Ceux qui n’ont pas de téléphone auront accès à une version imprimée.

Lire la suite sur le lien ci-dessous svp

 

http://

Partager cet article
Repost0
31 janvier 2021 7 31 /01 /janvier /2021 19:01
Covid-19 et Sras-Cov-2 — Les preuves d'une fraude globale ?
S'interroger sur le fait de savoir si le Sras-CoV-2 a été ou pas vraiment « isolé » peut sembler pertinent, d'autant que la généticienne Alexandra Henrion-Caude se pose la même question.
Covid-19 - Les preuves d'une fraude globale
L'article qui suit et les informations qu'il contient rend compte de certains faits qui posent question et qui sont par ailleurs peu débattus. Ces éléments ne suffiront sans doute pas à trancher la question, mais ils offrent, considérés dans leur ensemble, des éléments de réponses possibles, qui ouvrent eux-mêmes sur d'autres questionnements. Le tout étant par ailleurs parfois un peu technique, des explications supplémentaires portant sur des détails particuliers seront apportées au lecteur.

Toutefois, et pour mettre les choses en perspective dans le contexte qui est le nôtre aujourd'hui, à savoir que nous avons affaire à des psychopathes — et à des suiveurs autoritaristes souvent corrompus, au rang desquels se trouvent des scientifiques — qui usent de sophisme pour nous raconter une histoire (celle de leur pseudo-réalité), voici un extrait de l'ouvrage de Josef Pieper, Abus de langage, Abus de pouvoir :
« [les sophistes sont des] maîtres dans l'art de déformer les mots, grassement payés et acclamés par les foules [...] capables de faire l'éloge d'une chose mauvaise en la faisant apparaître comme bonne et qui [savent] avec maestria transformer le blanc en noir. [la sophistique est] un danger et une menace qui frappent la vie de l'esprit et celle de la société à toutes les époques. [...] les sophistes, doués d'une énorme sensibilité pour les nuances du langage et d'une dose extrême d'intelligence formelle, cultivent le mot, érigent et parfaissent l'usage du mot en art — et [...] ce faisant, ils corrompent en même temps le sens et la dignité du mot. [Il est essentiel] de reconnaître que quelque chose peut être magnifiquement fait, représenté, mis en scène, filmé brillamment et cependant être en même temps fondamentalement et essentiellement faux, et pas seulement faux, mais aussi mauvais, inférieur, lamentable, honteux, funeste, vil — et pourtant magnifiquement réalisé ! [...] la difficulté à reconnaître les sophistes fait partie du succès de ces derniers. »
On retrouve cet abus de langage au sein d'une mauvaise science devenue religieusement universelle dans laquelle il existe
« un phénomène de « corruption systémique », une entreprise de manipulation généralisée permettant de ne pas avoir besoin de soudoyer un grand nombre de personnes. La manipulation globale permet que des foules d'acteurs de bonne foi y participent en toute ignorance de cause. »
Voici donc la traduction de l'article écrit par Iain Davis sur son site Web In This Together.

* * * * * * * * * * * * * * * *

Le Covid-19, et les réponses gouvernementales qui ont suivi, semblent faire partie d'une conspiration internationale visant à commettre des fraudes. Il semble qu'aucune preuve n'existe pour démontrer qu'un virus appelé Sras-CoV-2 provoque une maladie appelée Covid-19. Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis prêt à être corrigé. Cependant, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur comité consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les sondes et les amorces génétiques utilisées dans les tests RT-PCR pour identifier le Sras-CoV-2 ne ciblent rien de spécifique. J'ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l'exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l'Organisation mondiale de la santé. Vous pouvez faire de même.

D-Salud-Discovery indique qu'il n'existe aucun test capable d'identifier le Sras-CoV-2. Par conséquent, toutes les allégations concernant l'impact présumé du Covid-19 sur la santé de la population sont sans fondement.

L'ensemble du récit officiel du Covid-19 est une supercherie. De toute évidence, il n'existe aucun fondement scientifique dans aucune des parties de ce récit.

Si ces affirmations sont exactes, nous pouvons déclarer qu'il n'existe pas de preuve de pandémie, mais seulement l'illusion d'une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n'est celles des ambitions de despotes sans scrupules qui souhaitent transformer l'économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d'innombrables crimes. Ces crimes peuvent et doivent faire l'objet d'une enquête et de poursuites devant un tribunal.
Note de MKS : Puisque l'auteur parle de parasites, voici quatre articles qui pourraient permettre au lecteur de creuser un peu plus :
The Great Reset

Qu'ont-ils identifié exactement ?

L'Organisation mondiale de la santé (OMS) a classifié la maladie Covid-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de Covid- 19 le 11 mars 2020.

Le guide de l'OMS sur les essais en laboratoire stipule ce qui suit :
« L'agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le Sras-CoV et le Mers-CoV) par un séquençage de nouvelle génération à partir de virus cultivés ou directement à partir d'échantillons reçus de plusieurs patients atteints de pneumonie. »
L'OMS affirme que le virus du Sras-CoV-2 est à l'origine du Covid-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l'OMS intitulé « Nouveau coronavirus 2019-nCov — Rapport de situation n° 1 », ils déclarent que :
« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 [...] Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l'utiliser dans le développement de kits de diagnostic spécifiques. »
Ces deux déclarations de l'OMS suggèrent clairement que le virus Sras-CoV-2 a été isolé (c'est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l'échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les villages aux quatre coins du globe. Selon l'OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause le Covid-19.

Pourtant, l'OMS affirme également :
« Travaillant directement à partir des informations sur les séquences, l'équipe a mis au point une série de tests d'amplification génétique (PCR) utilisés par les laboratoires. »
Les scientifiques de Wuhan ont développé leurs tests d'amplification génétique à partir d'« informations sur les séquences » parce qu'il n'y avait pas d'échantillon isolé et purifié du virus dit Sras-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines en épi [ou protéine Spike - NdT] contenant l'ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d'autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.
structures protéiques
Des virologues affirment qu'il n'est pas possible d'« isoler » un virus parce qu'il ne se réplique qu'à l'intérieur des cellules hôtes [et donc in vivo, et non in vitro dans lequel il est sorti de son environnement et ne peut par conséquent pas se comporter de la même manière - NdT]. Ils ajoutent que les postulats de Koch ne s'appliquent pas parce qu'ils concernent les bactéries — qui sont des organismes vivants. Par contre, ce que les virologues observent dans des cultures cellulaires, ce sont les effets cytopathogènes du virus qui provoquent la mutation et la dégradation des cellules.

Lorsque les chercheurs chinois ont au départ séquencé le génome complet du Sras-CoV-2, ils ont observé un effet cytopathogène dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire simienne immortalisée et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu'elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.
Note de MKS : Une lignée cellulaire immortalisée est une lignée qui a échappé à la senescence cellulaire (par un procédé chimique) et qui peut donc se diviser indéfiniment in vitro. Les cellules Vero sont une lignée cellulaire utilisée pour les cultures cellulaires. Les cellules Vero E6 sont un clone de la souche 76, elle-même découverte en 1968. La lignée de cellules Vero a été isolée et établie à partir de rein de singe vert adulte d'Afrique (Certopithecus aethiops) en mars 1962 par Y. Yasumura et Y. Kawakita à l'université de Chiba au Japon. Source
Au cœur de l'histoire officielle du Sras-CoV-2 se trouve l'idée qu'il s'agit d'un virus zoonotique, [qui serait - NdT] capable de combler le fossé entre les espèces, des animaux aux humains. Lorsque des scientifiques du CDC aux États-Unis ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :
« Nous avons examiné la capacité du Sras-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d'humains, y compris les cellules d'adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0), et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules simiennes]... Aucun effet cytopathogène n'a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules simiennes] ... Les cellules HUH7.0 et 293T n'ont montré qu'une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l'infection par le Sras-CoV-2. »
Le CDC n'a observé aucun effet cytopathogène dans les cellules humaines. Ils n'ont trouvé aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n'a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu'une infection d'homme à homme serait impossible.

Que le Sras-CoV-2 soit un virus humain capable de provoquer une maladie généralisée est loin d'être évident. Il se peut même qu'il n'existe pas physiquement. Ne serait-ce alors rien d'autre qu'un concept basé sur des séquences génétiques prédictives ?
Structure imagée du Sras-Cov-2
© Sott.net
Note de MKS : Notez que le Sras-CoV-2 imagé ci-dessus posséderait une protéine de surface (Spike) présentant une différence notable par rapport à d'autres coronavirus génétiquement proches. Ou plus exactement, le site de clivage de la protéine Spike du Sras-CoV-2 posséderait un insert (un fragment de peptide en plus) de quatre acides aminées, absent des protéines Spike de Sras-CoV. Source

À propos de l'origine soi-disant zoonotique, Judy Mikovits a déclaré ce qui suit : [...] Il n'a pas pu apparaître de façon naturelle. Le virus n'a pas pu passer directement à l'homme depuis une chauve-souris achetée au marché par un individu. Ça ne fonctionne pas ainsi. Il s'agit d'une évolution virale accélérée. S'il s'agissait d'un phénomène naturel, il faudrait jusqu'à 800 ans pour que le virus évolue de cette manière.

Rappelons aussi que le Dr Pekova suggérait dès avril dernier que le séquençage du Sras-CoV-2 « semble plutôt anormal, et qu'une restructuration aussi importante a peu de chances de se produire dans la nature, sans intervention humaine ».

Voyage de découverte

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le premier génome complet du Sras-CoV-2 (MN908947.1). Ce séquençage a été mis à jour à de nombreuses reprises. Toutefois, MN908947.1 fut le premier à avoir décrit le prétendu agent étiologique du Sras-Cov-2, à savoir le Covid-19.

Toutes les revendications, les tests, les traitements, les statistiques, le développement de vaccins et les politiques qui en découlent sont basés sur ce séquençage. Si les tests de ce nouveau virus n'identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit du Covid-19 n'est qu'une mascarade.

Les chercheurs de Wuhan ont déclaré qu'ils avaient efficacement reconstitué la séquence génétique du Sras-CoV-2 en faisant correspondre des fragments trouvés dans les échantillons avec d'autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1 % avec les coronavirus Sras (Sras-Cov). Ils ont utilisé l'assemblage de novo et la PCR ciblée, et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6 % au Sras-CoV.

Ils ont dû utiliser un assemblage de novo parce qu'ils n'avaient aucune connaissance préalable de la séquence ou de l'ordre corrects de ces fragments. En clair, la déclaration de l'OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.
Note de MKS : L'assemblage de novo est une technique de séquençage d'un génome inconnu. Il nécessite l'assemblage d'un très grand nombre de petites séquences de ce même génome. Il nécessite aussi un génome de référence (s'il en existe un) afin de positionner (par comparaison) les séquences obtenues. L'assemblage de novo nécessite pour reconstituer un génome complet des programmes bioinformatiques de pointe. Source

Avant de poursuivre, il est nécessaire de comprendre le principe du test PCR et l'usage qui en est fait dans le cadre de la « crise-Covid-19 ».

Il s'agit en tout premier lieu d'un procédé d'amplification moléculaire qui mime le processus naturel de synthèse de l'ADN.

La PCR ciblée est une technique de réplication ciblée in vitro — ou encore ACP pour « amplification en chaîne par polymérase ». Le principe consiste à obtenir, à partir d'un échantillon complexe et peu abondant, d'importantes quantités d'un fragment d'ADN spécifique et de longueur définie, dont l'ordre de grandeur à retenir est celui du million de copies en quelques heures, ce qui est généralement suffisant pour une utilisation ultérieure. Source

Pour Kary Mullis, l'inventeur de la technique PCR qui lui a permis de gagner le prix Nobel de chimie en 1993, cet examen était avant tout qualitatif et destiné à répondre à la question : l'élément est là, oui ou non, mais il n'était pas du tout destiné à le quantifier, et donc, certainement pas conçu pour poser un diagnostic :
« C'est un procédé qui est utilisé pour faire beaucoup de choses à partir de quelque chose. Ça ne dit pas si vous êtes malade. Ça ne dit pas que la chose que vous avez contractée va réellement vous nuire... »
Voir aussi l'avis d'Alexandra-Henrion Caude sur le sujet : « Covid-19, gestion sanitaire, tests PCR, vaccins ARN, stress — Interview avec Alexandra Henrion-Caude ».

Ces cycles d'amplification successifs, peuvent aller, voire dépassent 40. Plus on augmente le nombre de cycles, plus on sera certain de trouver plus de quelque chose, et même une très faible charge virale donnera un résultat positif — à quelque chose qui ressemble à un coronavirus, puisque ces tests détectent des particules virales, des séquences génétiques, mais PAS le virus en entier. Selon Bernard La Scola dans une étude publiée dans la revue European Journal of Clinical Microbiology & Infectious Diseases, « il n'est plus possible de cultiver du virus in vitro lorsque le cycle d'amplification dépasse 34 ». Multiplier ces cycles nécessitent en outre de nombreuses étapes complexes et sujettes à des erreurs, des fautes de stérilité et des contaminations.

Un article pré-publié sur le site medRxiv en juillet 2020 en fait la synthèse :
« Aucune culture virale n'a été obtenue à partir d'échantillons [...] avec des cycles d'amplification supérieurs à 24 ou 34, indiquent les chercheurs. La possibilité de cultiver du virus décroit lorsque les cycles d'amplification augmentent. »
Par ailleurs, et histoire de rajouter à la confusion, le nombre de cycles n'est pas le même d'un pays l'autre, voire d'un laboratoire à l'autre au sein d'un même pays...
L'équipe de Wuhan a utilisé 40 cycles d'amplification RT-qPCR pour faire correspondre des fragments d'ADNc (ADN complémentaire construit à partir de fragments d'ARN échantillonnés) avec le génome déjà connu et publié du coronavirus du Sras (Sras-CoV). Malheureusement, la précision du génome original du coronavirus du Sras n'est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié cinquante patients atteints du syndrome respiratoire aigu sévère (Sras). Ils ont prélevé des échantillons sur deux de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

À partir du matériel génétique trouvé, ils ont créé trente clones. Tandis qu'ils n'ont pu trouver aucune preuve d'un autre virus connu, ils ont toutefois trouvé dans un seul de ces échantillons clonés des séquences génétiques d'« origine inconnue ».
E Gene target sequence
En examinant ces séquences d'ARN inconnues, ils ont trouvé 57 % de correspondance avec le coronavirus bovin et le virus de l'hépatite murine et en ont déduit qu'il était de la famille des Coronaviridae. Considérant que ces séquences suggéraient la découverte d'un nouveau virus du Sras-CoV (toute nouvelle découverte étant par ailleurs considérée par les scientifiques comme une ambroisie), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :
« Les amorces pour détecter le nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du Sras, 22 présentaient des traces d'ARN de coronavirus humain associé à la pneumonie. »
Note de MKS : Bien que l'auteur l'aborde partiellement plus loin, il est utile d'expliquer rapidement ce qu'est une « amorce » (et une sonde) dans le langage de la recherche génétique, voyons les quatre étapes du test PCR (après le prélèvement).
  • La première étape est celle de la dénaturation réalisée à une température de 95°C, l'ADN double-brin est séparé en ses deux brins d'ADN constitutifs ;
  • La deuxième étape est celle de l'hybridation lors de laquelle un oligonucléotide (la sonde) s'apparie à la séquence d'ADN qui lui est complémentaire ;
  • La troisième étape est celle de la polymérisation dans laquelle un deuxième oligonucléotide, l'amorce, s'hybride en amont, à quelques paires de bases de distance de la sonde ;
  • La quatrième étape est celle de l'émission de fluorescence qui permet d'éventuellement détecter et quantifier un signal fluorescent à même de prouver la présence de ce qui est recherché.
Pour plus de détails, consultez cet article assez simplifié d'où j'ai tiré ce qui précède, ou celui-ci, bien plus fourni. Selon eurofins, les étapes 1 à 4 sont répétées de 35 à 50 fois. Un must !
La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs à ce nouveau virus présumé. Personne ne sait pourquoi l'autre moitié a été testée négative pour ce nouveau virus Sras-CoV. La question n'a pas été posée.

Ce supposé virus ne présentait qu'une correspondance de séquence de 57 % avec un coronavirus prétendument connu. Les 43 % restants étaient juste « ». Les données séquencées ont été produites et enregistrées en tant que nouveau génome auprès de la GenBank sous le numéro d'accès AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une séquence correspondant à 79,6 % à AY274119 et l'ont donc qualifiée de nouvelle souche de Sras-CoV (2019-nCoV — finalement rebaptisée Sras-CoV-2). Personne n'avait, à aucun moment de ce processus, produit d'échantillon isolé et purifié d'un quelconque virus. Tout ce qu'ils avaient, c'était des pourcentages de concordance de séquences avec d'autres pourcentages de concordance de séquences.

Ils n'ont rien isolé

Les scientifiques sont très agacés parce qu'ils n'arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. La raison en est que, jusqu'à présent, personne n'a fourni un seul échantillon purifié du virus Sras-CoV-2. Ce dont nous disposons, en revanche, c'est d'un génome complet et, comme nous sommes sur le point de le découvrir, celui-ci n'est pas particulièrement convaincant.

Les journalistes d'investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du Sras-CoV-2 de confirmer qu'il s'agissait bien d'images d'un virus isolé et purifié. Aucun d'entre eux n'a pu le faire.
Note de MKS : En préambule des réponses retranscrites ci-dessous, les auteurs de l'article stipule ce qui suit :
« Et comme les tests PCR sont calibrés pour les séquences de gènes (dans ce cas-ci les séquences d'ARN car on pense que le Sras-CoV-2 est un virus à ARN), nous devons savoir que ces extraits de gènes font partie du virus recherché. Et pour le savoir, il faut procéder à une isolation et une purification correctes du virus présumé.

C'est pourquoi nous avons demandé aux équipes scientifiques [auteurs] des documents pertinents auxquels il est fait référence dans le contexte du Sras-CoV-2 de prouver si les clichés au microscope électronique présentés dans leurs expériences in vitro montrent des virus purifiés. »
Voici les réponses de ces scientifiques :

Study 1: Leo L. M. Poon; Malik Peiris. "Emergence of a novel human coronavirus threatening human health" Nature Medicine, March 2020
Replying Author: Malik Peiris
Date: May 12, 2020
Answer: "The image is the virus budding from an infected cell. It is not purified virus." [L'image est le virus bourgeonnant d'une cellule infectée. Ce n'est pas un virus purifié.]

Study 2: Myung-Guk Han et al. "Identification of Coronavirus Isolated from a Patient in Korea with COVID-19", Osong Public Health and Research Perspectives, February 2020
Replying Author: Myung-Guk Han
Date: May 6, 2020
Answer: "We could not estimate the degree of purification because we do not purify and concentrate the virus cultured in cells." [Nous n'avons pas pu estimer le degré de purification car nous ne purifions pas et ne concentrons pas le virus cultivé dans les cellules.]

Study 3: Wan Beom Park et al. "Virus Isolation from the First Patient with SARS-CoV-2 in Korea", Journal of Korean Medical Science, February 24, 2020
Replying Author: Wan Beom Park
Date: March 19, 2020
Answer: "We did not obtain an electron micrograph showing the degree of purification." [Nous n'avons pas obtenu de micrographie électronique montrant le degré de purification.]

Study 4: Na Zhu et al., "A Novel Coronavirus from Patients with Pneumonia in China", 2019, New England Journal of Medicine, February 20, 2020
Replying Author: Wenjie Tan
Date: March 18, 2020
Answer: "[We show] an image of sedimented virus particles, not purified ones." [[Nous montrons] une image de particules de virus sédimentées, et non pas purifiées.]
 

En Australie, des scientifiques de l'Institut Doherty ont annoncé qu'ils avaient isolé le virus Sras-CoV-2. Lorsqu'on leur a demandé de préciser, les scientifiques ont déclaré [le 29 janvier 2020]:

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic. »

Ceci explique pourquoi le gouvernement australien a déclaré [le 4 décembre 2020] :

« La fiabilité des tests Covid-19 est incertaine en raison de la base de preuves limitée... Il existe peu de preuves disponibles pour évaluer la précision et l'utilité clinique des tests Covid-19 disponibles. »

Au Royaume-Uni, en juillet, un groupe d'universitaires inquiets a écrit une lettre au Premier ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus Covid-19 a été isolé. »

Ils n'ont, à ce jour, pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a présenté aux autorités nationales en charge de la santé publique en Angleterre [PHE en anglais - NdT] une requête en vertu de la loi sur la liberté de l'information. Il leur a demandé de lui fournir leurs dossiers décrivant la façon dont le virus du Sras-COV-2 avait été isolé. Ce à quoi ils ont répondu :

« PHE peut confirmer qu'il ne détient pas d'informations de la manière suggérée par votre demande. »

La chercheuse canadienne Christine Massey a fait une demande d'accès à l'information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n'avons pu trouver aucun document répondant à votre demande. »

Aux États-Unis, le Panel de diagnostic RT-PCR du Centre de contrôle des maladies (CDC) indique ce qui suit :

« [...] Aucun isolat quantifié du virus 2019-nCoV n'est actuellement disponible [...] La détection de l'ARN viral pourrait ne pas indiquer la présence d'un virus infectieux ou que le 2019-nCoV est l'agent responsable des symptômes cliniques. »

Dans leur dernière mise à jour du 13 juillet 2020, les CDC n'ont pas encore obtenu d'échantillon viral pur d'un patient dit atteint de la maladie de Covid-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le Sras-CoV-2 est présent ou cause le Covid-19.

On nous dit que rien de tout cela n'a d'importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons nous contenter d'images de choses dont nous savons qu'elles pourraient être autre chose et de séquences génétiques (qui pourraient être n'importe quoi d'autre) comme autant de preuves concluantes que ce virus, et la maladie qu'il est censé causer, sont réels.

Orf1 Gene Human Chromosome Match

Tester en vain

L'OMS, ainsi que tous les gouvernements, les think-thank, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l'exposé officiel du Covid-19, affirment que le Sras-CoV-2 provoque le Covid-19. Alors que personne n'a jamais produit d'échantillon de ce supposé virus, le prétendu génome du Sras-CoV-2 a été publié. Il relève du domaine public.

Au sein du génome du Sras-CoV-2, des séquences génétiques clés auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s'agit notamment des quatre suivantes :

  • Le gène de l'ARN polymérase ARN-dépendante (Rd-Rp) — Il permet à l'ARN du Sras-CoV-2 de se répliquer à l'intérieur du cytoplasme des cellules épithéliales malades du Covid-19 ;
  • Le gène S (ORF2) — Cette glycoprotéine forme le pic [Spike - NdT] à la surface du virion du Sras-CoV-2 qui est censé faciliter la liaison du Sras-CoV-2 aux récepteurs ACE2 des cellules, permettant à l'ARN à l'intérieur de l'enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée ;
  • Le gène E (ORF1ab) — C'est une petite protéine membranaire utilisée dans l'assemblage du virus ;
  • Le gène N (ORF9a) — Il s'agit du gène de la nucléocapside qui se lie à l'ARN lors de la formation de la capside.

L'OMS tient un registre accessible au public des amorces et des sondes RT-PCR utilisées pour tester le Sras-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s'annulent) aux brins anti-sens et sensoriels de l'ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d'ADNc (ADN complémentaire construit à partir de fragments d'ARN échantillonnés) se séparent lorsqu'ils sont chauffés et se reforment lorsqu'ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s'hybrider à des régions cibles spécifiques du génome viral présumé. Au cours de l'amplification, alors que les régions entre les amorces s'allongent, lorsqu'une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C'est de l'identification de ces marqueurs que les scientifiques prétendent prouver la présence du Sras-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST) [il s'agit d'une méthode de recherche heuristique utilisée en bioinformatique. Le BLAST permet de trouver les régions similaires entre deux ou plusieurs séquences de nucléotides ou d'acides aminés, et de réaliser un alignement de ces régions homologues - NdT]. Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc « BLASTER » [rechercher] les amorces, les sondes et les séquences de gènes cibles qui ont été déclarées dans la recherche du Sras-CoV-2.

BLAST - Basic Local Alignment Search Tool Sras Cov2

Les amorces et les protocoles de sonde de l'OMS pour le génome viral présumé du Sras-CoV-2 sont basés sur les profils des gènes Rd-Rp, ORF1, N et E. N'importe qui peut les soumettre à l'analyse de BLAST et découvrir les résultats.

La séquence nucléotidique vitale Rd-RP, utilisée comme amorce avant, est — ATGAGCTTAGTCCTGTTG. Si nous lançons une recherche nucléotidique sur BLAST, celle-ci est enregistrée comme correspondant à l'isolation complète du Sras-CoV-2 avec une identité de séquence identique à 100 %. De même, la séquence d'amorce du gène E inverse — ATATTGCAGCAGTACGCACACA — révèle la présence de la séquence ORF1ab qui identifie également le Sras-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence Rd-Rp du Sras-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100 %. La recherche sur le ORF1ab (gène E) en trouve 90 avec une identité de séquence de 100 % avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes dont la séquence correspond à 100 % au gène du Sras-CoV-2 E, et 100 microbes dont la séquence correspond à 100 % au gène vital Rd-Rp du Sras-CoV-2 .

Chaque fois que nous vérifions les soi-disant marqueurs génétiques uniques au Sras-CoV-2 qui sont enregistrés dans les protocoles de l'OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le Sras-CoV-2, ne sont pas uniques. Elles pourraient être n'importe quoi, depuis des séquences microbiennes jusqu'à des fragments de chromosomes humains.

Les soi-disant vérificateurs-de-faits (fact-checkers), comme le projet Health Feedback de Reuters, se sont empressés de rejeter les revendications de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du Sras-CoV-2. Ils utilisent une ribambelle d'arguments bidons comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n'est pas le cas), ce qui fait que leur tentative de démystification aboutit à quelque chose comme ça :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L'amorce avant peut se lier à un chromosome particulier, mais l'amorce arrière ne se lie pas au même chromosome et le chromosome n'est donc pas présent dans le virus Sras-CoV-2. De plus, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence d'ADNc entre les amorces est unique au virus. »

Cette façon de faire semble déformer de manière délibérée la portée des observations émises en amont en avançant un argument que personne, à part les vérificateurs-de-faits eux-mêmes, ne fait valoir. Les recherches effectuées sur BLAST montrent que ces séquences cibles ne sont pas uniques au Sras-CoV-2. Pas plus qu'il n'est nécessaire de trouver toutes les cibles pour qu'un résultat soit jugé positif.

Fact-Checkers
© Inconnu

Des chercheurs marocains ont enquêté sur l'épidémiologie des cas marocains présumés du Sras-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de l'évoquer, beaucoup d'entre eux n'étaient peut-être positifs à aucun.

Ceci est tout à fait conforme aux directives de l'OMS en matière de tests. Elles stipulent que

« Un diagnostic optimal consiste en un test d'amplification de l'acide nucléique (TAAN) avec au moins deux cibles indépendantes du génome du Sras-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé [...] Un ou plusieurs résultats négatifs n'excluent pas nécessairement une infection par le Sras-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs-de-faits grassement rémunérés, si les amorces avant et arrière identifient des débris, l'une identifiant peut-être le fragment d'un chromosome et l'autre une séquence microbienne, alors la région amplifiée située entre elles est probablement aussi un débris.

L'argument selon lequel la RT-PCR ne trouve que de l'ARN est spécieux. La transcription naturelle (la séparation des brins d'ADN) se produit pendant l'expression des gènes. Personne ne dit que dans le prétendu génome du Sras-CoV-2 l'entièreté des chromosomes ou des microbes sont séquencés. Même s'il est possible que ce soit effectivement le cas, pour ce que l'on en sait. Ce qui est avancé [par ceux qui interroge les méthodes de dépistage - NdT], c'est que les prétendus marqueurs utilisés pour tester ce supposé virus ne sont pas adaptés à l'objectif.

Séquençage Sras Cov2

Les tests RT-PCR ne séquencent pas l'intégralité du génome. Ils recherchent des occurrences de fluorescence de sondes spécifiques pour indiquer la présence de séquences supposées exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d'ARN extraites d'ADN non codant, parfois appelé « poubelle » (ADNc).

Note de MKS : À propos de l'ADN « poubelle », voir cet article du Dr Gaby : « L'ADN « poubelle » viral, le régime cétogène qui améliore l'ADN et les effets cométaires ».

Par exemple, le gène S du Sras-CoV-2 est censé être hautement spécifique au génome du virus du Sras-CoV-2. La séquence cible est — TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d'identité de 100 %. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95 %. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100 % avec 86 fragments de chromosomes humains.

Quel que soit l'endroit où l'on regarde dans le supposé génome du Sras-CoV-2, rien dans les protocoles de test de l'OMS ne permet d'identifier clairement de quoi il s'agit. L'ensemble du génome pourrait être faux. Les tests ne prouvent pas l'existence du Sras-CoV-2. Tout ce qu'ils révèlent, c'est une soupe de matériel génétique non spécifié.

Si tel est le cas — et puisqu'il n'y a pas d'isolats ou d'échantillons purifiés du virus — aucune preuve de l'existence du Sras-CoV-2 sans test viable ne peut exister. Par conséquent, il n'existe pas non plus de preuve de l'existence d'une maladie appelée Covid-19.

Cela signifie qu'il n'y a pas de base scientifique pour toute affirmation concernant le nombre de cas de Covid-19, les admissions à l'hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Note de MKS : Sur rien de « scientifique », mais sur une nécessité psychopathique servie par une certaine science, sans aucun doute.

Fraude et conspiration

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l'intention de priver un tiers de son droit, ou de lui causer un préjudice d'une manière ou d'une autre. »

La définition juridique d'une conspiration est la suivante

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel. »

Il semblerait que ceux qui prétendent que nous sommes confrontés à une pandémie n'aient fourni aucune preuve montrant qu'un virus appelé Sras-CoV-2 provoque une maladie appelée Covid-19. Toutes les informations suggérant fortement qu'une telle probabilité existe sont facilement accessibles dans le domaine public. Tout le monde peut les lire.

Pour qu'il y ait fraude, la tromperie doit être délibérée. L'intention doit être de priver délibérément d'autres personnes de leurs droits ou de leur porter préjudice d'une manière ou d'une autre. S'il existe des preuves de collusion entre des individus et/ou des organisations à des fins frauduleuses, il s'agit alors d'une conspiration (dans les pays qui appliquent la Common law) ou d'une entreprise criminelle commune en vertu du Droit international.

Note de MKS : La Common law est système juridique anglo-saxon dont les règles sont principalement édictées par les tribunaux au fur et à mesure des décisions individuelles, et non sur le Droit civil comme en France qui s'appuie sur le Droit codifié — encore que la France fait de plus en plus souvent fi du Droit codifié pour le remplacer par la Common law, dont la jurisprudence a toujours été l'élément fondamental. Généralement, les pays sous la Common law sont les anciennes colonies ou les anciens protectorats britanniques y compris les Etats-Unis (à la seule exception de la Louisiane où s'applique un droit codifié.)

Il semble que le Covid-19 ait été délibérément utilisé comme casus belli pour mener une guerre contre l'humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de flâner a été restreinte, la liberté de parole et d'expression a été érodée, les droits de manifester ont été réduits, nous avons été séparés de nos proches, et nos sociétés ont été détruites, soumises à des assauts psychologiques, muselées et terrorisées.

Prince Charles

Le Prince Charles nous demande d'accueillir la Grande réinitialisation à bras ouverts

Pire encore, alors qu'il n'existe pas de preuve d'une mortalité sans précédent toutes causes confondues, on a enregistré des pics de mortalité anormaux. Ces pics correspondent précisément aux mesures de « confinement » qui ont entraîné une interruption des soins de santé primaires et une réorientation des services de santé publique financés par nos impôts pour traiter à l'exclusion de toutes les autres une prétendue maladie.

En outre, ceux qui ont présenté et fait circuler le récit Covid-19 proposent que cette prétendue maladie justifie la restructuration complète de l'économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l'humanité elle-même.

Pour être autorisés à participer à leur soi-disant « nouvelle normalité » [ou nouvelle réalité, soit leur pseudo-réalité - NdT], à savoir la transformation complète sans notre consentement de toute notre société, ils exigent que nous nous soumettions à leurs conditions.

Ces mesures comprennent, sans s'y limiter, une surveillance biométrique de chacun, un contrôle et un suivi centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives, jusqu'à celle qui exige clairement que nous renoncions à toute forme de souveraineté sur nos propres corps. Toutes ces mesures constituent les conditions qui prévalent dans l'esclavage.

Il ne fait aucun doute que nos droits ont été bafoués et que nous en avons été dépouillés. Dans les pays qui exercent la Common law, l'innocence est présumée, mais il n'empêche que les preuves d'un préjudice délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, émanent clairement de think tanks mondialistes et d'institutions supranationales, et ont été élaborées bien avant l'émergence de cette soi-disant pandémie.

Dans les pays soumis au Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils faudrait qu'ils puissent prouver que, en dépit de leurs ressources incommensurables, ils ont été collectivement incapables d'accéder ou de comprendre l'une des preuves librement disponibles suggérant que le Covid-19 est un mythe.

Note de MKS : Le Code Napoléon est aussi appelé Code civil, et la présomption d'innocence est le principe selon lequel toute personne, qui se voit reprocher une infraction, est réputée innocente tant que sa culpabilité n'a pas été légalement démontrée. La plupart des pays d'Europe reconnaissent et utilisent le principe de la présomption d'innocence selon l'article 6 de la Convention européenne des droits de l'homme. Toutefois, il est des cas, tout du moins en France, où la présomption de culpabilité existe en vertu des exceptions au droit à la présomption d'innocence. Ces exceptions sont légales et la charge de la preuve de la non-culpabilité repose alors sur le prévenu.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S'ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d'entre nous s'efforce de réparer les dommages qu'ils ont déjà causés.

Source de l'article initialement publié en anglais le 16 novembre 2020 : In This Together
Traduction : Sott.net

* * * * * * * * * * * * * * * *

Alors, fraude totale ou partielle ?

Si l'on part du principe, comme postulé ici, que le Sras-Cov-2 est d'origine humaine, et qu'il est donc « réel », faut-il donc en déduire que le séquençage qui en a été fait est faux, bidouillé, falsifié, suffisamment pour en cacher certains éléments, parmi ceux qui pourraient servir les psychopathes au pouvoir, mais pas assez pour en révéler certains aspects ? Encore que les éléments de preuve développés dans « Les preuves irréfutables de l'origine humaine du Sras-Cov-2 » proposent justement d'y répondre :

« Nous avons tout au long de cet article examiné les preuves suggérant que le Sras-Cov-2 a été fabriqué à Fort Detrick et qu'il a été incorporé dans un vaccin dans le but explicite de se propager à grande échelle et d'affecter les fonctions neurologiques associées à l'obéissance.

Il semble que ce projet ait toutefois échoué, d'abord parce que le « virus de l'obéissance » a muté en un « virus de la désobéissance », ce qui a contraint les pouvoirs publics à prendre — à tout prix — des mesures hâtives en vue de limiter la propagation du mutant bénéfique.

Le confinement général fut une tentative désespérée de minimiser la propagation des effets potentiellement bénéfiques de la mutation du Sras-Cov-2. »

Au départ, il y a une fabrication. Puis s'en est suivi une mutation. Le séquençage « officiel » du Sras-Cov-2 correspond-il au virus initial ou à sa mutation ? Ou à un autre « état » intermédiaire ?

Quoiqu'il en soit, c'est une question à laquelle il est pour le moment difficile de répondre, et il est possible que nous n'en saurons jamais rien. Nous avons plus que certainement des lacunes tant techniques que factuelles pour comprendre les tenants (mais pas les aboutissants) de tout ceci. Tout ce que nous savons, à ce stade, c'est que ce virus est utilisé pour tenter d'imposer aux populations terrorisées un monde dystopique — par le biais notamment d'un programme économique et politique totalitaire qui se propose d'avancer des conjectures et des théories malsaines sur ce à quoi le monde post-soi-disant-pandémique devrait ressembler.

« Faites-vous vacciner pour protéger les autres ! » « Pas de vaccin = pas de travail, pas de shopping, pas de voyage, pas de socialisation ! ». En gros, vous êtes libre de choisir entre le passeport d'immunité ou une peine de prison à vie dans une cellule isolée.

Pour conclure, qu'est-ce que la « science » ? Selon Nissim Amzallag :

« La science ne distille pas forcément le vrai, cela nous le savons depuis le début du XXe siècle. Et pourtant, une aura d'objectivité continue de protéger la science de toute critique non seulement sur ses fondements, mais encore sur la manière dont elle s'impose pour façonner la société. »

L'auteur dans son ouvrage La réforme du vraiEnquête sur les sources de la modernité, publié en 2010 aux Éditions Charles Léopold Mayer, « explore les fondements sur lesquels s'est appuyée la révolution scientifique et les métamorphoses qu'elle a induites dans la société. » Nissim Amzallag plonge dans des considérations historiques pour essayer de comprendre si la science naissante, dite moderne depuis la pomme de Newton (mythe fondateur, s'il en est), « fut réellement motivée par un désir sincère d'intelligence du réel ». C'est loin d'être le cas :

« les innovations les plus importantes, conceptuelles comme pratiques, dérivent de parti pris étrangers à toute exigence du réel ».

Son livre s'adresse à tous ceux qui souhaitent s'émanciper « de l'autorité d'une idéologie maquillée en savoir » en prenant conscience de l'existence d'une réforme du vrai. Ou devrait-on l'appeler « réforme du réel » ? En effet, il est difficile, quand on les connaît toutes les deux, de ne pas faire le lien entre l'existence des pseudo-réalités psychopathiques et la réforme du vrai de l'auteur, une réforme qui permet justement la mise en place de la dite pseudo-réalité. Dans son ouvrage, il en aborde en 2010 toutes les étapes sauf celle, finale, mais vouée à l'échec de par sa nature utopique, que nous expérimentons aujourd'hui.

Partager cet article
Repost0
31 janvier 2021 7 31 /01 /janvier /2021 18:34
Les Israëliens ploient sous les contaminations... Où est le paradis qu'on nous promettait après les vaccins ?
 

http://

Si son ambitieuse campagne de vaccination devrait rapidement porter ses fruits, le pays ploie sous les contaminations, en dépit du confinement en vigueur.

Principale voie d'entrée et de sortie du pays, l'aéroport international Ben-Gourion, à Tel-Aviv, est totalement fermé depuis le 26 janvier, même pour les citoyens israéliens bloqués à l'étranger. Le confinement national doit durer jusqu'au 31 janvier, mais des responsables de la santé exigent une prolongation supplémentaire d'au moins une semaine, c'est-à-dire jusqu'au 8 février. Il faut dire que, pour l'instant, rien ne marche comme prévu sur le front sanitaire.

Malgré la très importante campagne de vaccination – plus de 2,6 millions de personnes ont reçu la première dose et plus de 1,3 millions ont reçu la deuxième...
 
 
1/3 de la population  à été vaccinée !
Les vaccinés favorisent les mutation du corona...
Le vaccin n'a aucune efficacité !
Partager cet article
Repost0

Pages